ID: 947523638

View in Genome Browser
Species Human (GRCh38)
Location 2:230865881-230865903
Sequence GTCCCCCGACCCCACGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947523624_947523638 21 Left 947523624 2:230865837-230865859 CCTGCTCCCCTCTCTTTTCTCCA 0: 1
1: 1
2: 2
3: 84
4: 987
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523623_947523638 22 Left 947523623 2:230865836-230865858 CCCTGCTCCCCTCTCTTTTCTCC 0: 1
1: 0
2: 12
3: 183
4: 1619
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523630_947523638 1 Left 947523630 2:230865857-230865879 CCATTCCCAGCCTCTCGCTGGGC 0: 1
1: 0
2: 2
3: 46
4: 342
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523631_947523638 -4 Left 947523631 2:230865862-230865884 CCCAGCCTCTCGCTGGGCTGTCC 0: 1
1: 0
2: 0
3: 19
4: 226
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523633_947523638 -9 Left 947523633 2:230865867-230865889 CCTCTCGCTGGGCTGTCCCCCGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523622_947523638 25 Left 947523622 2:230865833-230865855 CCTCCCTGCTCCCCTCTCTTTTC 0: 1
1: 0
2: 9
3: 186
4: 1746
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523627_947523638 13 Left 947523627 2:230865845-230865867 CCTCTCTTTTCTCCATTCCCAGC 0: 1
1: 0
2: 2
3: 71
4: 662
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523626_947523638 14 Left 947523626 2:230865844-230865866 CCCTCTCTTTTCTCCATTCCCAG 0: 1
1: 0
2: 8
3: 112
4: 866
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523625_947523638 15 Left 947523625 2:230865843-230865865 CCCCTCTCTTTTCTCCATTCCCA 0: 1
1: 1
2: 10
3: 113
4: 1164
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86
947523632_947523638 -5 Left 947523632 2:230865863-230865885 CCAGCCTCTCGCTGGGCTGTCCC 0: 1
1: 0
2: 3
3: 36
4: 318
Right 947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947523638 Original CRISPR GTCCCCCGACCCCACGGGGA GGG Intronic
900249681 1:1661288-1661310 GACCCCAGAGCCCACGAGGAGGG + Intronic
900260718 1:1727195-1727217 GACCCCAGAGCCCACGAGGAGGG + Intronic
901491463 1:9598432-9598454 TTCCCCCAACCCCACAGGGCAGG + Exonic
901811023 1:11766829-11766851 GTCCCCTGACCCTAGGGGGTGGG - Intronic
902234766 1:15050339-15050361 GTCCTCAGACCCCACTGGGGAGG + Intronic
904424722 1:30415931-30415953 GTCCTCCCACCCCACAGGGCAGG - Intergenic
905665905 1:39763047-39763069 GGCCCCCCACCCCAGGGGGCTGG + Intronic
920039311 1:203085453-203085475 ATCCCCCTGCCCCAAGGGGACGG - Intronic
920433220 1:205932112-205932134 GCTTCCCGACCCCAGGGGGATGG + Intronic
1062951409 10:1506764-1506786 GTACCCCAACCCCAAAGGGATGG + Intronic
1074357616 10:112799874-112799896 GTCCCCCCAGCCCAGGTGGAGGG - Intronic
1082816773 11:57514621-57514643 GTCGCCCGGCCCCAGAGGGAAGG - Intronic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1083890278 11:65592451-65592473 GATCCCCGACCCCACGGGCGGGG + Exonic
1084641790 11:70430603-70430625 GTCCCCAGACCCCATGGGGAGGG - Intronic
1084941925 11:72617596-72617618 TTCCCCAAACCCCAGGGGGAGGG + Intronic
1085299009 11:75447764-75447786 TTCCCCTGCCCCCACTGGGAAGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089938719 11:122393549-122393571 GTCTCCTGACCGCCCGGGGATGG + Intergenic
1095948881 12:47770724-47770746 CTCCCCCAGCCCCAAGGGGAGGG + Intronic
1103275988 12:119712385-119712407 TTCCCCCGTTCCCACTGGGAGGG + Intronic
1103724697 12:122991826-122991848 GCCCCTCTCCCCCACGGGGACGG - Intronic
1104500585 12:129281938-129281960 CTCCACCAACCCCACAGGGAGGG - Intronic
1104635665 12:130436785-130436807 GTCCCCAAACCCCACGGGACGGG - Intronic
1104676697 12:130716051-130716073 GCCCCCGGACCCCACGCTGAAGG + Intronic
1108075623 13:46676250-46676272 TTCCCCCCACCCCACCGAGACGG - Intronic
1112467110 13:99654088-99654110 GTCCCCCTACCCCACGTGGTGGG - Intronic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1115469488 14:33754094-33754116 GCCCCGCGACCCCACTGGGGTGG + Intronic
1117297329 14:54392296-54392318 GGCCCCTGAGGCCACGGGGAGGG - Intergenic
1118174197 14:63421768-63421790 GTCCCCCAACCCCACGTTGCAGG - Intronic
1125429369 15:39580534-39580556 GTGTCCTCACCCCACGGGGACGG + Intergenic
1128638073 15:69315893-69315915 CTGCCCCGAGCCCAAGGGGAAGG - Intronic
1133450048 16:5896350-5896372 ATCCTCCCACCCCACAGGGAGGG - Intergenic
1134835657 16:17358476-17358498 GTCAAGCCACCCCACGGGGAGGG + Intronic
1137557227 16:49478311-49478333 TGCCCCTGTCCCCACGGGGATGG + Intergenic
1138651867 16:58465242-58465264 GTCCTCCGACACCTGGGGGAGGG + Intronic
1139750726 16:69107446-69107468 TTCCCACGACCCAACCGGGAAGG - Intronic
1142618117 17:1148469-1148491 GTCCCCAGCCCCCCCGGGCATGG + Intronic
1142901980 17:3017981-3018003 GTCTACAGACCCCACGAGGAGGG + Intronic
1147822934 17:43252523-43252545 TTCCCCCGTCCCCTCGGGTACGG - Intergenic
1148079090 17:44957652-44957674 ATCTCCAGACCCCACAGGGAAGG + Intergenic
1148698827 17:49576366-49576388 TTCCCCCGACATCCCGGGGATGG + Intronic
1151071045 17:71211981-71212003 CTCCCCTGACACCAAGGGGAAGG - Intergenic
1151683559 17:75634254-75634276 GTCCCCTGCCCCCAGGGTGAAGG + Intronic
1151851230 17:76691250-76691272 GTACCCCAACTCCATGGGGACGG + Intronic
1157488439 18:48106145-48106167 GTCCCCGCACCACACGGGGAGGG + Intronic
1159564117 18:70028871-70028893 GTCCCGTGACCCAAAGGGGAGGG - Intronic
1160578094 18:79868312-79868334 GTCACCAGGCCCCACGCGGAGGG - Intronic
1160578107 18:79868367-79868389 GTCACCAGGCCCCACGCGGAGGG - Intronic
1161452010 19:4351524-4351546 GACCTCCAACTCCACGGGGATGG - Intronic
1161561246 19:4973733-4973755 GTTCCCCGCCCCAACAGGGAAGG - Intronic
1163567426 19:18059833-18059855 GCCCCCCCACCCCCCGGGCAGGG + Intronic
1166888526 19:45975485-45975507 GTCCCCAGAGCCAAGGGGGATGG + Intergenic
1167260717 19:48456204-48456226 GCCCCCCCAGCCCACGGGGGTGG + Exonic
1168175240 19:54623850-54623872 TTCCCCCGGCCCCGCAGGGAGGG + Intronic
1168282273 19:55312060-55312082 CTGCCCTGACCCCACGGGGCCGG + Exonic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
947723320 2:232381930-232381952 GTCCCCAGAGCGCACGGGGAGGG - Exonic
948011381 2:234651945-234651967 CTCCCCTGACACCAAGGGGAGGG + Intergenic
948616943 2:239205078-239205100 GTCTCCCCACCCCACGTGGCTGG + Intronic
1172426654 20:34860224-34860246 GTCCCTGGTCCCCAGGGGGAGGG + Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1183401741 22:37608965-37608987 GTACCCCGCCCCCGCCGGGAAGG - Intronic
1183512307 22:38243404-38243426 GTCCCCCGACCACACAGGAGAGG + Intronic
1183649542 22:39145919-39145941 TTCCCCCGACCCCCCGGGAAAGG - Intronic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
1184836871 22:47029181-47029203 GTCCCCGGGCCCCATGGGGAGGG - Intronic
1184836910 22:47029294-47029316 GTTCCCGGGCCCCACGGGAAGGG - Intronic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
965795850 3:172437955-172437977 TTCCCCTGACCCAACTGGGAAGG - Intergenic
966146026 3:176813224-176813246 TTCCCCCGACCCTACCTGGATGG + Intergenic
968225452 3:196969570-196969592 GCCCGCCGATCCCACGGGCACGG - Intergenic
968452831 4:683236-683258 AGCCCCCTCCCCCACGGGGAAGG + Exonic
969232301 4:5840212-5840234 GTCCTCCCACCCCAGGGGAAAGG + Intronic
976390067 4:84497890-84497912 GGCCCCCGAGGCCACGGGCATGG + Exonic
985834870 5:2262854-2262876 CTTCCCCGACCCCAAGGGCAGGG + Intergenic
993851459 5:93015352-93015374 GCCCCCCCACCCCACTGGGGAGG - Intergenic
997818357 5:137039602-137039624 GTCCCACGCCCCCATGGGCAGGG + Intronic
1006162618 6:32047110-32047132 GTACCCCGTCCCCACAGTGAGGG + Intronic
1006603042 6:35238407-35238429 TTCCCCAGAGCCCACTGGGAAGG - Intronic
1006914668 6:37586468-37586490 GGCCCCCGACCCCACTGCGATGG - Intergenic
1016246219 6:141984219-141984241 GTCCCCAGACCCCTTGGGGAAGG - Intergenic
1019781063 7:2939995-2940017 TTCCCCCGATCCCACTGGGCTGG + Intronic
1019917076 7:4140411-4140433 GACCCCCGGCCCCACGATGAGGG + Intronic
1022535215 7:31094251-31094273 GGCCCCCCACCCCACAGGGCAGG - Intronic
1025128584 7:56364098-56364120 GGCCCCCGTCCCCAGGGGTAGGG - Intergenic
1027052286 7:75027931-75027953 GGCCCCAGACCCCACTTGGAGGG + Intronic
1037751763 8:21686900-21686922 ATCCCCCTACCCCACTGGAAAGG + Intergenic
1037827011 8:22165560-22165582 GCCCCCCGGCCCCCCGGCGACGG + Intronic
1040626980 8:49160428-49160450 GTCCCCTGACCCCACGTGCCTGG - Intergenic
1049799015 8:144509246-144509268 GGCCTCTGACCCCACGCGGAGGG + Exonic
1053509069 9:38671939-38671961 GTCTCTAGCCCCCACGGGGAGGG - Intergenic
1058066015 9:100548929-100548951 GTCCCCCCACCCCAGTGGGGTGG + Intronic
1062162637 9:135088392-135088414 CTCCCCCGGCCCCGCGGCGAGGG - Intronic