ID: 947523986

View in Genome Browser
Species Human (GRCh38)
Location 2:230867450-230867472
Sequence CAGAGCTACAGCTGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947523986_947523992 3 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523992 2:230867476-230867498 GCCGAGGGATGGCAGCCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 250
947523986_947523997 21 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523997 2:230867494-230867516 GGAGGCTGCTTTCTCAGGGCAGG 0: 1
1: 0
2: 3
3: 34
4: 325
947523986_947523998 22 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523998 2:230867495-230867517 GAGGCTGCTTTCTCAGGGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 288
947523986_947523991 0 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523991 2:230867473-230867495 TGAGCCGAGGGATGGCAGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 233
947523986_947523995 17 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523995 2:230867490-230867512 GCCAGGAGGCTGCTTTCTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 274
947523986_947523990 -8 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523990 2:230867465-230867487 TAGCTCTGTGAGCCGAGGGATGG 0: 1
1: 0
2: 1
3: 27
4: 196
947523986_947523994 16 Left 947523986 2:230867450-230867472 CCCATTTCTCAGCTGTAGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 947523994 2:230867489-230867511 AGCCAGGAGGCTGCTTTCTCAGG 0: 1
1: 0
2: 3
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947523986 Original CRISPR CAGAGCTACAGCTGAGAAAT GGG (reversed) Intronic
900782044 1:4624696-4624718 GAGAACTACAAGTGAGAAATTGG + Intergenic
905608280 1:39324501-39324523 ATGAGCTACAGCTGATAAAAAGG - Intronic
906229675 1:44150902-44150924 CAGAGCAAGAGTTGAGAATTGGG + Intergenic
906642331 1:47449045-47449067 CAGAGCGACAGCTGAGGGAGGGG - Intergenic
907711064 1:56881911-56881933 CAGAGCCACAACTTAGAAATAGG - Intronic
908640103 1:66213006-66213028 CTGAGCCACTGCTGAGAAAGAGG - Intronic
910534442 1:88280598-88280620 CAGAGATTAAGCTGAGAAAATGG - Intergenic
910752783 1:90652581-90652603 CAGAGCTCAGGCTGAGAAAAGGG - Intergenic
911780887 1:101876521-101876543 CAGAGCTAGAGCTATTAAATTGG - Intronic
914742376 1:150476025-150476047 CAGTGATACAGTTCAGAAATAGG + Intronic
915245505 1:154553409-154553431 CAGAGCTGCAGCTGAGATCGAGG + Intronic
915725072 1:158011588-158011610 CAGACCTACCCCTGAGAAAGGGG - Intronic
916338753 1:163704176-163704198 AAGAGCTACAGCTGAATACTTGG + Intergenic
916517680 1:165535006-165535028 CACAGCTACAGTTGAGATCTGGG + Intergenic
920706161 1:208252153-208252175 CAGGGACAGAGCTGAGAAATAGG + Intergenic
922132191 1:222790887-222790909 CAGAGCTAAAGCTCAGACCTTGG + Intergenic
922177318 1:223206705-223206727 CAGACCTACCGCTGAGAATCTGG + Intergenic
923361110 1:233211946-233211968 CAGGGCAACAGCCGAGAAATGGG - Intronic
1063949845 10:11212225-11212247 CAGGGTGACAGCTGGGAAATGGG + Intronic
1064525473 10:16251327-16251349 CAAACCTACTGATGAGAAATTGG + Intergenic
1068976909 10:63020114-63020136 CAGAGTTACAGTTGCAAAATGGG - Intergenic
1072728937 10:97831829-97831851 CAGATCTACAGCTGGGCAGTGGG + Intergenic
1073821282 10:107267247-107267269 CAGAGATCCAGCTTATAAATTGG - Intergenic
1074188744 10:111117710-111117732 CACTGCTACTGCTGAGACATGGG + Intergenic
1074848927 10:117422965-117422987 GAGAGCTGCAGCTGAGCCATAGG - Intergenic
1075919812 10:126201353-126201375 CAGAGATACAGAAGAGAAACAGG + Intronic
1077382569 11:2251119-2251141 CAGAGCTACAGCTGAGCGTAGGG + Intergenic
1080285460 11:30606324-30606346 CAGTGCTATTGGTGAGAAATGGG - Intergenic
1081491089 11:43569588-43569610 CAAAGCTACAGCTGGGCAAGGGG - Intronic
1084549625 11:69833448-69833470 CAGAGCTACAACTGATAACCTGG - Intergenic
1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG + Intergenic
1087216213 11:95497903-95497925 CAGAGCCACAGATGGAAAATAGG + Intergenic
1088351904 11:108899183-108899205 CAGAACTACTGCAGAGAAAAGGG - Intronic
1090407426 11:126485371-126485393 ATGAGCTCCAGCTGAGAAGTGGG - Intronic
1093475130 12:19546575-19546597 TAAAGCTAAAGCTGAGGAATTGG + Intronic
1094423588 12:30296942-30296964 TAAAGCGACAGCTGAGAAGTGGG + Intergenic
1096172071 12:49479513-49479535 GACAGCTACAGCTGGGAGATGGG + Intronic
1097033148 12:56104232-56104254 CGGAGCTACGGCGGGGAAATAGG - Intronic
1098609487 12:72437352-72437374 CAGAAATACAACGGAGAAATGGG - Intronic
1100569363 12:95832525-95832547 CAAAGAGACAGGTGAGAAATGGG + Intergenic
1100853427 12:98737282-98737304 CAAAGCTACAGAAGAGAACTTGG - Intronic
1101951560 12:109180077-109180099 CCCAGCTACAGGTGAGAAAATGG + Exonic
1102340371 12:112116754-112116776 CAGAGCCGCAGCTGATAACTGGG - Intergenic
1104800878 12:131554605-131554627 CAGTCCTACAGCTGAGAACAGGG - Intergenic
1104924718 12:132308230-132308252 CTGAGCTACAGCTGAGCTATGGG - Intronic
1107788573 13:43978234-43978256 CAGTGTTACAGTTGAGGAATAGG - Intergenic
1107917246 13:45165478-45165500 CTAATATACAGCTGAGAAATCGG - Intronic
1108502361 13:51080181-51080203 CAGATCTCCAGCTGAGTACTGGG + Intergenic
1108554299 13:51578128-51578150 CAGAGCTGGAGATGAGAATTTGG + Intergenic
1108604826 13:52026948-52026970 AACAGGAACAGCTGAGAAATGGG + Intronic
1110284068 13:73729479-73729501 CAATCTTACAGCTGAGAAATAGG + Intronic
1110956815 13:81562745-81562767 CAGAGCTGGGGGTGAGAAATGGG + Intergenic
1112712903 13:102150903-102150925 CAGAGCTGAGGCTGAGAAACTGG + Intronic
1113009988 13:105753264-105753286 TATAGCTAAAGCTGAGCAATTGG + Intergenic
1116543800 14:46136451-46136473 CAGAGCTTCAGCATAGAAACTGG + Intergenic
1117224923 14:53646741-53646763 AAGAGCTACACCCCAGAAATAGG - Intergenic
1118612747 14:67554267-67554289 CAGAATTTCAGCTGAGAGATTGG + Intronic
1119551539 14:75517539-75517561 CAGAGCCTCAGCTGATAACTTGG + Intergenic
1120188544 14:81419381-81419403 CAGTGATACAGCTGTGAAAATGG - Intronic
1120226054 14:81791944-81791966 CAGAGTTGCAGCAGAGAAAGAGG - Intergenic
1126747330 15:51839133-51839155 CAGATTGACAGCTAAGAAATAGG + Intronic
1127126706 15:55819155-55819177 GAGAGCAACTGCAGAGAAATTGG + Intergenic
1127752929 15:62063868-62063890 CACAGCTACAGCTGGGAGCTTGG + Intergenic
1130513273 15:84606517-84606539 GACAGCTACAGCTGTAAAATAGG - Intronic
1134114963 16:11541144-11541166 CATAGATACAGATGACAAATTGG - Intergenic
1134131178 16:11651226-11651248 CACAGCTACAGCTGGGAGCTGGG + Intergenic
1134882542 16:17758263-17758285 CAGAGCCTCAGCTGCCAAATGGG + Intergenic
1139193518 16:64892084-64892106 CAGATTCACAGCTCAGAAATGGG + Intergenic
1140074064 16:71680243-71680265 CAGAGCAATAGCTAACAAATAGG + Intronic
1140738167 16:77917610-77917632 CAGGGCTACAGATAAGAAAACGG + Intronic
1140809550 16:78564312-78564334 CAGGCCTACAGCTGAGGAAAAGG - Intronic
1142627374 17:1200898-1200920 CAGGGCTACAGCTTAGAGACTGG + Intronic
1143573576 17:7776581-7776603 CAGAGCCACAGCTCAGAAAGGGG - Intronic
1145981752 17:29016802-29016824 CAGAGCATCAGCTGGGAAAGAGG - Intronic
1146617901 17:34371188-34371210 GCCAGCCACAGCTGAGAAATAGG - Intergenic
1147534768 17:41312624-41312646 CAGAGCAGCAGCTGATACATTGG + Intergenic
1147966197 17:44195500-44195522 CAGAGGTACAGGTTAGAGATGGG + Intronic
1148627572 17:49081392-49081414 CTGGGCTACAGCAGAGAAAGAGG - Intergenic
1149538758 17:57452864-57452886 CAGTGCCACAGCTGAGAGGTGGG + Intronic
1151160854 17:72164429-72164451 CAGGGGTCCAGCTGAGAAGTGGG - Intergenic
1152901738 17:82945457-82945479 CAGTGCTGCTGCTGGGAAATTGG - Intronic
1153107515 18:1544470-1544492 GAGAGCTACAAGTGAGAAATTGG + Intergenic
1155344539 18:24845560-24845582 CAGAGCTATACCTGAGTATTGGG + Intergenic
1156953848 18:42937450-42937472 CAGAGGTACAGCGGAGAAGGTGG + Intronic
1158067080 18:53423534-53423556 CACAGCTAAGGCTGAGAAAATGG - Intronic
1158153949 18:54404371-54404393 CAGACCTACTGCAGAGAGATGGG - Intergenic
1158248126 18:55454557-55454579 CAGATCTATAGCTAAGGAATTGG - Intronic
1159199400 18:65164584-65164606 AAGAAATACAGCTTAGAAATGGG + Intergenic
1159306549 18:66650648-66650670 CAAAGCTACAGTTGAGGTATTGG - Intergenic
1162912571 19:13856684-13856706 GACAGCTACAGCTGAGAACTTGG + Intergenic
1164557501 19:29265132-29265154 CAGCGCTGCATCTGTGAAATGGG + Intergenic
1164571570 19:29378487-29378509 CAAAGCAACAGCTAAGAAATGGG - Intergenic
1164798332 19:31054646-31054668 CAGACCTACAGCTAAGCACTTGG + Intergenic
1164810742 19:31153886-31153908 CAGGGCTAAGGCTGAGAATTGGG - Intergenic
1167558579 19:50211026-50211048 ATGAGCTATATCTGAGAAATTGG - Intronic
1167786340 19:51640339-51640361 CAGAGCTACAGTGCAGAAAGTGG + Intronic
1168227263 19:55004743-55004765 CAGAGCTGCAGCTGAGCCACAGG - Intergenic
1168649222 19:58082620-58082642 CACAGGTTCGGCTGAGAAATGGG + Intronic
930121633 2:47765551-47765573 CTGAGCTTCAGCACAGAAATGGG - Intronic
931445303 2:62322334-62322356 CAGAACATCATCTGAGAAATGGG - Intergenic
932806609 2:74789797-74789819 CAGAGGTACAGCTGAGTGAGAGG - Intergenic
933622259 2:84556365-84556387 CAGCGCTACAGTGCAGAAATAGG - Intronic
933779584 2:85792188-85792210 CAGGGCCACGGCTGAGAAAGAGG - Intergenic
934515704 2:94985195-94985217 CAGAGGAGGAGCTGAGAAATGGG - Intergenic
935049172 2:99509622-99509644 CAGAGCCACAGCTGTGATCTGGG + Intergenic
935088257 2:99869401-99869423 CAGCTCTACAGCTGACACATGGG - Intronic
935847670 2:107184386-107184408 CTCATCTACAGCTGAGAAAAGGG - Intergenic
937828290 2:126391558-126391580 CTGAAATAGAGCTGAGAAATTGG - Intergenic
940262416 2:151795045-151795067 CAGAGCTCCAGTGGTGAAATTGG + Intronic
940541146 2:155020399-155020421 CAGAACTATAGCTGGGCAATGGG - Intergenic
941443586 2:165570471-165570493 GAGAACAAGAGCTGAGAAATTGG - Intronic
942495440 2:176535001-176535023 CAGAGCTGCCACTGAGAAAGGGG - Intergenic
942751711 2:179295235-179295257 CAGAGCTAATGCTAAGCAATAGG - Intergenic
945014055 2:205496289-205496311 AAGAGCTACAAATCAGAAATTGG + Intronic
946547056 2:220755671-220755693 AAGAGCTTCACCTGAGAAGTGGG - Intergenic
947523986 2:230867450-230867472 CAGAGCTACAGCTGAGAAATGGG - Intronic
947743935 2:232497948-232497970 CAGAGATAAAGCTGAGACTTGGG + Intergenic
948977817 2:241474396-241474418 CAGGGCTAGAGCTGAGCACTGGG + Intronic
1169959617 20:11144641-11144663 CTCAGCTGCAGCTGGGAAATGGG + Intergenic
1171025699 20:21628680-21628702 CAGTGCTGCAGCTGAGGAAATGG - Intergenic
1171203926 20:23264753-23264775 CAGAGCAGGAGCTGAGAAAGTGG + Intergenic
1171358798 20:24572120-24572142 CAGTGCTACAGCTGAGGAGATGG - Intronic
1172344110 20:34183615-34183637 AAGAGTTACAGCTGTGAAATTGG - Intergenic
1173291076 20:41715759-41715781 GAGAACTACAGATAAGAAATGGG + Intergenic
1174279406 20:49427923-49427945 CTGGGCCACAGCTGAGAAAAGGG - Intronic
1174982263 20:55409073-55409095 CATAGCCACTGCTGAGAGATGGG + Intergenic
1175200680 20:57275068-57275090 CAGATCTTCATCTGTGAAATGGG - Intergenic
1177811527 21:25929894-25929916 CAGAGCTCCAGCAGAAAAAATGG - Intronic
1177992313 21:28052474-28052496 CTGAGCTACAGTTGATAGATGGG + Intergenic
1179040289 21:37796654-37796676 CAGGGCTACATCTGGGAAGTTGG - Intronic
1179841065 21:44074164-44074186 CAGAGCTACAGGAGAGAGAAAGG - Intronic
1182548830 22:31090445-31090467 CACAGCTCCAGCTGGGAGATGGG - Intronic
1183099448 22:35574937-35574959 CAGAGATCCAGCTGAGGAAAGGG + Intergenic
1183208659 22:36436357-36436379 CAGAACAGCAGATGAGAAATGGG + Intergenic
950224794 3:11224803-11224825 CAGAGCCTCATCTGAAAAATGGG + Intronic
950630599 3:14279380-14279402 CAGAGCTACAGGTGCAAGATGGG + Intergenic
954365460 3:50143754-50143776 CAGGCCTAGAGCTGAGAGATGGG - Intergenic
954941390 3:54376197-54376219 CAGAGCTGCAGGTGTGGAATGGG - Intronic
959356908 3:105343367-105343389 CAAAGCTACTGCTTAGACATTGG + Intergenic
959429886 3:106240175-106240197 GATTGCTACAGCTGAGAAAACGG + Intergenic
959646182 3:108704671-108704693 CATAGGTACAGCTTAGGAATTGG - Intergenic
960832790 3:121867445-121867467 CATGGCTTCAGATGAGAAATAGG - Intronic
960846833 3:122011746-122011768 CACAGCAACAACTGAGATATGGG - Intronic
962208494 3:133455817-133455839 CAGTGCCCCGGCTGAGAAATTGG - Intronic
962271426 3:133980478-133980500 CAGCGCAACAGCTGAGAACCTGG - Intronic
963556481 3:146795755-146795777 CAGATCTACAGTTGGCAAATTGG + Intergenic
965100528 3:164292179-164292201 CAGATCTACAGCTGTGTACTGGG - Intergenic
966673868 3:182563274-182563296 CTGAGCTCCAGCTGAGACACAGG + Intergenic
967238521 3:187412767-187412789 CAGATCTCCAGCTGCGAACTGGG - Intergenic
967250423 3:187532096-187532118 TTGAGCTACAGCTAAAAAATGGG + Intergenic
967365111 3:188677608-188677630 CAGAACTTCTGCTGGGAAATGGG + Intronic
970265031 4:14273119-14273141 AAGAGCTTCAGCTGATTAATTGG + Intergenic
971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG + Intergenic
975007729 4:69311605-69311627 AAAAGCTACAGTTGACAAATGGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977971187 4:103216167-103216189 CAGAACTACAAGTAAGAAATGGG + Intergenic
978139661 4:105303556-105303578 CAAAGTTTCTGCTGAGAAATTGG - Intergenic
978607513 4:110497693-110497715 CATAGCTACAGCGGAAAAAAAGG + Intronic
982473503 4:155822555-155822577 CAGAGTTAAGGATGAGAAATGGG - Intergenic
987046651 5:14115312-14115334 CTGGGCTACAGCAGAGAAAGAGG + Intergenic
987761441 5:22167551-22167573 CAGGCCTACAGAAGAGAAATGGG - Intronic
988967955 5:36439034-36439056 AAGAGTCACAGCTGAGGAATAGG + Intergenic
989056334 5:37369431-37369453 CAGAGCAACGGATGAAAAATTGG + Intronic
991896235 5:71401019-71401041 CAGGCCTACAGAAGAGAAATGGG - Intergenic
994888122 5:105593132-105593154 GAGAACTACAAATGAGAAATGGG - Intergenic
995880114 5:116835552-116835574 GAGAGCTGCAGCTGTGAAAAGGG + Intergenic
996115280 5:119611302-119611324 CTGAGGTACAGGTCAGAAATGGG + Intronic
996539916 5:124619600-124619622 CAGAACTAAAACTTAGAAATAGG + Intergenic
997391578 5:133521275-133521297 CAGAGATTCAGCTGAGCAGTCGG + Intronic
997395802 5:133558839-133558861 CACAGCCACAGGAGAGAAATGGG + Intronic
998294996 5:140960755-140960777 AAGAGTTACAGAGGAGAAATAGG + Intronic
998302279 5:141035100-141035122 CAAAACTACAGATGGGAAATGGG - Intergenic
998771151 5:145547340-145547362 CAGAGCTACAGAAGATAAAATGG - Intronic
998885968 5:146693893-146693915 CAGTGTTACAGATAAGAAATAGG - Intronic
999518048 5:152320778-152320800 CAGCCCTACAGGTGAGTAATAGG - Intergenic
999539971 5:152560656-152560678 AAGAGCAACAGCTTGGAAATGGG - Intergenic
1001754994 5:174161427-174161449 CAGTTTTACAGCTGAGAAACAGG + Intronic
1002305202 5:178279023-178279045 CAGATCTTCATCTGTGAAATGGG - Intronic
1002933033 6:1647331-1647353 CAGAGCTACTGGGGAGACATGGG + Intronic
1003581027 6:7341066-7341088 CAGAGCTGCAGCTGTGAAAGGGG + Intronic
1004017852 6:11748713-11748735 AAAAGCTACAGCTGAGCCATGGG + Intronic
1004306581 6:14506777-14506799 AAGGGCTACAGAAGAGAAATGGG - Intergenic
1004584589 6:16987232-16987254 CAGAGCAAGAGCTGAGAGAAAGG + Intergenic
1004778630 6:18879139-18879161 CAGAACTTCAGCAGATAAATAGG - Intergenic
1005004558 6:21274705-21274727 CAGAGCATCAGTTTAGAAATTGG - Intergenic
1007187424 6:39984184-39984206 CAGAGCTAGAACTGAGGAATAGG - Intergenic
1007923214 6:45629356-45629378 CAGATCTATAGGAGAGAAATGGG + Intronic
1007978764 6:46129424-46129446 ATGAGTTACAGCTGAGAAATGGG - Intergenic
1008710659 6:54222648-54222670 CAGAACTATAGCCAAGAAATGGG - Intronic
1013379429 6:109552714-109552736 AAAAGCTACAGTTGACAAATGGG - Intronic
1014254147 6:119144737-119144759 CAGAGCTCTGGCTAAGAAATGGG + Intronic
1017399016 6:154038738-154038760 CAGAGCTTCACCCTAGAAATTGG + Intronic
1018738802 6:166711530-166711552 CAGAGCCTCAGCTAAGGAATGGG + Intronic
1019561435 7:1660759-1660781 CAGAACTACAGTTCTGAAATTGG - Intergenic
1020516968 7:9134203-9134225 CAGGGTTACACATGAGAAATGGG - Intergenic
1020698644 7:11448807-11448829 CACATCTAAAGCTAAGAAATAGG - Intronic
1023244503 7:38186864-38186886 TAGAGCCAAAGCTGAGAAAGGGG + Intronic
1024126460 7:46302617-46302639 CAGATGTGCAGGTGAGAAATAGG - Intergenic
1024888658 7:54176294-54176316 CGGAGGGACTGCTGAGAAATGGG - Intergenic
1028034377 7:85961415-85961437 TAGAGCTACAGGTGAGGCATAGG + Intergenic
1028400009 7:90415243-90415265 CTCAGCTACATCTGAGAAAAAGG - Exonic
1029253659 7:99254362-99254384 CAAAGCTTCATCTGTGAAATGGG - Intergenic
1030253983 7:107486085-107486107 CAGAGATAAAGCTGAAAAATAGG + Intronic
1030808247 7:113943894-113943916 AAGATATACAGATGAGAAATTGG - Intronic
1031213987 7:118867343-118867365 CAGAGTTACAGCTAAGAAAGAGG - Intergenic
1032187502 7:129739914-129739936 CAGAGCTGCTGCTGAAAAATGGG + Intronic
1033401582 7:141030668-141030690 AAGAAGTACAGATGAGAAATAGG + Intergenic
1033443131 7:141397916-141397938 GAGAGCTAGAGCTGTGATATTGG + Intronic
1033504351 7:141985447-141985469 CAGATCTACAGCTGTGTACTGGG + Intronic
1036215791 8:6878565-6878587 CAGAGCTACAACTGCCAGATTGG + Intergenic
1038023258 8:23567889-23567911 CATATCTACAGCTGAGAAGGGGG - Intronic
1038391665 8:27207553-27207575 CAGAACCACAGCTGATAAATGGG + Intergenic
1043504211 8:80886463-80886485 CAGCCCTACAGCAGAGAGATGGG - Intergenic
1045989138 8:108285407-108285429 TTGCGCTACATCTGAGAAATTGG - Intronic
1047363723 8:124193234-124193256 CATAGCCACAGCTGAGCACTTGG - Intergenic
1047716433 8:127599721-127599743 CATAGCTCCAGCTGAGATCTGGG + Intergenic
1049676629 8:143892125-143892147 CAGGGCTGCTGCTGAGAAATCGG - Intergenic
1052170721 9:25392804-25392826 CAGGGGTCCAGCTGAGAATTTGG + Intergenic
1053159187 9:35801769-35801791 CAGAGGAACAGCTGAGACAAGGG - Intronic
1056943454 9:90974774-90974796 CACAGCTACATTTGTGAAATGGG - Intergenic
1059517459 9:114909003-114909025 CATTGCTGCATCTGAGAAATGGG - Intronic
1060205609 9:121681069-121681091 CACACCTACAGCTGAAACATTGG + Intronic
1060426376 9:123510123-123510145 CTGGGCTACAGCAGAGAAGTGGG - Intronic
1186314760 X:8357110-8357132 CAAAGCTAAAGCCAAGAAATGGG + Intergenic
1186821900 X:13297322-13297344 CACAGTTATAGATGAGAAATAGG - Intergenic
1188391527 X:29626749-29626771 CAGAGATCCAGCTGAGTAATGGG - Intronic
1188412658 X:29893108-29893130 CAGAGCAACAGCTCAGTAAACGG - Intronic
1188554263 X:31394277-31394299 CAGAGCTACAGCTGAGATTCTGG - Intronic
1190128706 X:47726869-47726891 CAAACCTACAGGTGTGAAATAGG - Intergenic
1191670046 X:63740614-63740636 CAAAGCCAAAGCTGAGAAATGGG + Intronic
1193487364 X:82103035-82103057 GAGAGCTAAAGCTTGGAAATGGG + Intergenic
1193912147 X:87318312-87318334 CACAGCTACTGCTGGCAAATGGG + Intergenic
1195379659 X:104258254-104258276 CACAGCAATAGTTGAGAAATAGG + Intergenic
1195438605 X:104875011-104875033 CAGTGTTACATCTGAAAAATGGG + Intronic
1196264687 X:113628500-113628522 CAGATCTACAGGAGAAAAATTGG - Intergenic
1196742962 X:119041405-119041427 CACAGCTGCAGCTGAGTCATAGG + Intergenic
1199409775 X:147507983-147508005 CAGAGAAAATGCTGAGAAATTGG + Intergenic
1199438544 X:147841996-147842018 CAGAGCTTCATCTGGGGAATGGG - Intergenic
1201224024 Y:11799640-11799662 AAAGGCTACATCTGAGAAATAGG + Intergenic