ID: 947527217

View in Genome Browser
Species Human (GRCh38)
Location 2:230886125-230886147
Sequence TGACATGGCCAGGGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947527217_947527233 15 Left 947527217 2:230886125-230886147 CCCTGCCCACCCTGGCCATGTCA No data
Right 947527233 2:230886163-230886185 GCACCTCCAGCTCTCTGCCTGGG No data
947527217_947527228 -8 Left 947527217 2:230886125-230886147 CCCTGCCCACCCTGGCCATGTCA No data
Right 947527228 2:230886140-230886162 CCATGTCAGGTGTGGGGCCCTGG No data
947527217_947527232 14 Left 947527217 2:230886125-230886147 CCCTGCCCACCCTGGCCATGTCA No data
Right 947527232 2:230886162-230886184 GGCACCTCCAGCTCTCTGCCTGG No data
947527217_947527229 -7 Left 947527217 2:230886125-230886147 CCCTGCCCACCCTGGCCATGTCA No data
Right 947527229 2:230886141-230886163 CATGTCAGGTGTGGGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947527217 Original CRISPR TGACATGGCCAGGGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr