ID: 947530383

View in Genome Browser
Species Human (GRCh38)
Location 2:230905291-230905313
Sequence GTGCCAGAGTTGACTAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947530383_947530386 9 Left 947530383 2:230905291-230905313 CCAGATCTAGTCAACTCTGGCAC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 947530386 2:230905323-230905345 AAACTCTGTGTGGCCTCCACCGG 0: 1
1: 1
2: 0
3: 8
4: 139
947530383_947530384 -1 Left 947530383 2:230905291-230905313 CCAGATCTAGTCAACTCTGGCAC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 947530384 2:230905313-230905335 CAACTTTCCTAAACTCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947530383 Original CRISPR GTGCCAGAGTTGACTAGATC TGG (reversed) Intergenic
900102638 1:968441-968463 GTGCCAGGATTGACTACATGTGG + Intronic
905198964 1:36303748-36303770 GTGCCAGAGTGAACAAGATGTGG - Intronic
912282177 1:108327562-108327584 GTGGCAGTGGTGCCTAGATCTGG + Intergenic
913695940 1:121325743-121325765 TTTCCAGATTTCACTAGATCTGG + Intronic
914141624 1:144954316-144954338 TTTCCAGATTTCACTAGATCTGG - Intronic
920483266 1:206344111-206344133 TTTCCAGATTTCACTAGATCTGG + Intronic
924549567 1:245062976-245062998 AAGCCAGGGTTGACTAGATTAGG - Intronic
1064929847 10:20613267-20613289 GTGTCAGAGTTGAATTGAACTGG - Intergenic
1070722918 10:78769107-78769129 GTGCCAGAGGTGACTGTAGCGGG + Intergenic
1072713582 10:97734750-97734772 CTGCCAGAGTTGAATACACCAGG + Intergenic
1073373159 10:103008942-103008964 GTCCCACAGTTGAGTATATCAGG - Intronic
1074080294 10:110163089-110163111 GGGCCAGAGTTGGCCAGAGCCGG - Intergenic
1077744737 11:4890139-4890161 GTGCCAGAGTTGCCAAAATGGGG - Intronic
1078200497 11:9178202-9178224 ATTCCCGAGTTGACAAGATCAGG - Exonic
1096808316 12:54154140-54154162 ATGCAAAAGTGGACTAGATCTGG + Intergenic
1101041733 12:100762354-100762376 GTGCCTGAGGTGGCTAGTTCTGG - Intronic
1108808493 13:54189294-54189316 GAGCTAGAATTTACTAGATCTGG - Intergenic
1112179480 13:97063524-97063546 TGGCCAGAGTTGATTAGACCAGG - Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1127127519 15:55826362-55826384 CTGCCCGAGTTGGCTAGAACAGG + Intergenic
1133378572 16:5310464-5310486 GTGCCTGAGTTCACTATACCTGG - Intergenic
1153491605 18:5655239-5655261 GAGCCAGACTTGGCCAGATCAGG + Intergenic
1164593136 19:29517070-29517092 GTGCCAGAGTTGATGGGCTCTGG - Intergenic
928448399 2:31353869-31353891 GTGCCAGAGGAGACCAGATCGGG + Intronic
928642640 2:33316526-33316548 ATGCCAGATTTGACTAGAACTGG + Intronic
929891224 2:45919890-45919912 GTGCCAGTGTTCACTAGGTGTGG + Intronic
934227438 2:90146407-90146429 GTGCTATAGATGACTAGATAGGG + Intergenic
942086248 2:172446708-172446730 ATGCCACATTTGACAAGATCTGG + Intronic
944485128 2:200197391-200197413 GTACCAGAGTTGACTTTCTCAGG - Intergenic
947530383 2:230905291-230905313 GTGCCAGAGTTGACTAGATCTGG - Intergenic
1171344856 20:24458507-24458529 GTGCCAGGGTTGTGTAAATCAGG - Intergenic
1173497658 20:43530927-43530949 GTGCCAGAGTTCACTGCAGCTGG + Intronic
1178484103 21:33006108-33006130 GTGCCAGGGTTGACTCCTTCTGG - Intergenic
1182077784 22:27506635-27506657 GTCCCCGAGGAGACTAGATCTGG - Intergenic
950635029 3:14308315-14308337 GGGCCAGAGATGAAGAGATCTGG - Intergenic
954774835 3:53007476-53007498 GTGCCAGAGTTGAGAAATTCTGG + Intronic
956382233 3:68676651-68676673 GTGCCAGAGTAGACAAGAAAGGG - Intergenic
956427611 3:69153276-69153298 GTCCCAGAGTTGATGTGATCTGG + Intergenic
963245277 3:143052634-143052656 GTGGCAGAGTTGAGTAGTTGTGG + Intronic
970736543 4:19176600-19176622 GTTCCAGAGTTGACTAGTAATGG - Intergenic
970756777 4:19436873-19436895 GTTCCAGAGATCACTAGAACAGG - Intergenic
970827701 4:20296660-20296682 GTGCCTTAGTTGACTAAATGTGG + Intronic
972090849 4:35281450-35281472 GGGCCAGAGGTGACGAGTTCAGG - Intergenic
974496675 4:62638087-62638109 GTGCAATTGTTGACTAGATGGGG - Intergenic
980711614 4:136576127-136576149 GTGCTGGAGTTGAGAAGATCTGG + Intergenic
980803026 4:137777193-137777215 GGGCCAGAGTAGACTTGATTAGG - Intergenic
981009166 4:139907066-139907088 CTGCCAGATTTGACTACATGAGG + Intronic
983926750 4:173410939-173410961 GTCTCAGAGTAGACTAGTTCTGG + Intergenic
993085576 5:83359356-83359378 TAGCCAGAGTTGATTAGATCAGG + Intergenic
998372924 5:141672689-141672711 GTGCCAGAAGGGACTAGTTCAGG + Intronic
1004290278 6:14360755-14360777 GTGTCAGAGTTGACTCGATATGG + Intergenic
1007346029 6:41229885-41229907 GTGCCAGACTTGACTTCAGCTGG + Intronic
1015417386 6:132964752-132964774 TTGCCAGAGCTAACTAGAACAGG + Intergenic
1016083342 6:139882050-139882072 GTGCCTATGTTGACCAGATCAGG - Intergenic
1016750426 6:147625383-147625405 GTGCCAGTGTTGACTTTATTTGG - Intronic
1055949916 9:81720977-81720999 GTGGCAGAGTTGAGTAGTTGCGG + Intergenic
1056838066 9:89973990-89974012 CTTCCAGAGTTGACTGGATTGGG - Intergenic
1060532681 9:124357252-124357274 GTGACAGAGTTGAGTAGGTGTGG - Intronic
1187749587 X:22447094-22447116 TTTCCAGAGTTGACTAGAGTTGG - Intergenic
1189063725 X:37783480-37783502 GTGCCAGTGCTGACTAGAAGAGG - Exonic
1198517196 X:137421403-137421425 GTAATAGAGTTGACTGGATCGGG - Intergenic
1199597975 X:149523020-149523042 ATGCCAGATTTGCCCAGATCAGG - Intronic