ID: 947531739

View in Genome Browser
Species Human (GRCh38)
Location 2:230913205-230913227
Sequence AGTCATAGGAATGCTTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947531739 Original CRISPR AGTCATAGGAATGCTTATTG TGG (reversed) Intronic
909364770 1:74806587-74806609 CTTCATAGGAATGTTTAGTGGGG - Intergenic
909549254 1:76879422-76879444 AGGCATAAGAATGCATATTAAGG - Intronic
910231328 1:84990503-84990525 AGTTATAGAAATGTTAATTGCGG + Intronic
910639272 1:89442226-89442248 AGCCATAGGAATTGTTATTAAGG - Intergenic
914808549 1:151009277-151009299 AGGCAAAGGAATGCTGGTTGTGG - Intronic
916106642 1:161437565-161437587 AGGCATTGGAATGGATATTGAGG - Intergenic
917255636 1:173113128-173113150 AGTCAAAGGAAAGATTATGGAGG + Intergenic
918148840 1:181781064-181781086 AGTCAGGGGAATGCTAATCGAGG + Intronic
919627017 1:199921113-199921135 AGAAAAGGGAATGCTTATTGGGG - Intergenic
1064517946 10:16170500-16170522 AGGCATGGGAATGGTTATTAAGG - Intergenic
1067185592 10:44024518-44024540 GGTCTTAGGAATGCTGTTTGGGG + Intergenic
1068610222 10:59051432-59051454 ATGCATAAGTATGCTTATTGAGG - Intergenic
1069192619 10:65508632-65508654 AGACATAGGAATGGATATTAAGG - Intergenic
1069256545 10:66338318-66338340 AGACATAAGAGTTCTTATTGTGG + Intronic
1071393289 10:85196577-85196599 AGAAATAGAAAAGCTTATTGTGG - Intergenic
1071766121 10:88667569-88667591 AGTCAGATGATTACTTATTGGGG + Exonic
1071861303 10:89675687-89675709 ATTCAAAGGAATGCAAATTGTGG + Intergenic
1072360180 10:94651885-94651907 AGTCATGGGAATGGATATTAAGG + Intergenic
1072525550 10:96268337-96268359 GATCATAGGAATGTTTACTGTGG + Intronic
1074888709 10:117717024-117717046 GGCCTTAGGAATGCTTATTGTGG + Intergenic
1075331804 10:121579393-121579415 AGTCAGAGGAATGCGAATAGAGG - Intronic
1076095950 10:127735553-127735575 TGTCAAAGGAATGCTAGTTGTGG - Intergenic
1081002989 11:37697216-37697238 ATTCATATGAATGGTTGTTGAGG - Intergenic
1082671394 11:56040772-56040794 AGGCATAGGAATGGATATTAAGG + Intergenic
1086828160 11:91525832-91525854 AGTAATACGAATTGTTATTGAGG + Intergenic
1087373763 11:97318487-97318509 AGGCATAGGAATGGATATTAAGG + Intergenic
1087903529 11:103669656-103669678 ATTCAAAGGAATGCATTTTGAGG + Intergenic
1088147114 11:106694655-106694677 AATCATGGGAATGCATATTTAGG + Intronic
1090103277 11:123824607-123824629 AGGCATACGTATGTTTATTGTGG - Intergenic
1090209961 11:124912050-124912072 AGTCATGGGAATGGATATTAAGG - Intergenic
1090221906 11:125033871-125033893 AGTCATGGGAATGGATATTAAGG - Intronic
1091051440 11:132376462-132376484 AGTCATGGGAATGGATATTAAGG + Intergenic
1097431802 12:59518497-59518519 AGGCATAGGAATGGATATTAAGG - Intergenic
1100149429 12:91717802-91717824 AGTCATAGGCTTGATTTTTGTGG - Intergenic
1103013070 12:117472762-117472784 AGAAATAATAATGCTTATTGAGG + Intronic
1103419881 12:120771818-120771840 AGCCACAGGAATGCGTGTTGAGG - Intronic
1106245843 13:27949421-27949443 TGGCATGGGAATGCTTATTTTGG - Intergenic
1107506231 13:41036647-41036669 ATGCATACGTATGCTTATTGCGG + Intronic
1107769229 13:43772349-43772371 AGTGGGAGGAATGCTTTTTGGGG - Intronic
1108371768 13:49776818-49776840 ATACTTGGGAATGCTTATTGAGG - Intronic
1108871262 13:54989042-54989064 AAGCATAGGAATGCTTTTGGAGG - Intergenic
1109000486 13:56796267-56796289 ATGCATATGAATGTTTATTGTGG + Intergenic
1109160925 13:58973088-58973110 AATCATATTTATGCTTATTGAGG - Intergenic
1116335280 14:43649290-43649312 GGTCATAGGCATGGTTATTTTGG + Intergenic
1119093902 14:71811226-71811248 AGGCACAGGTATGTTTATTGTGG + Intergenic
1125401930 15:39313187-39313209 TGCCATAGGTGTGCTTATTGGGG - Intergenic
1127057661 15:55148846-55148868 ATTCACACGTATGCTTATTGCGG + Intergenic
1129632085 15:77271473-77271495 ATGCATATGTATGCTTATTGTGG + Intronic
1141559849 16:84860319-84860341 AGTCATGGGAATGGATATTAAGG - Intronic
1143746839 17:9001252-9001274 AGTCATTTTAATGGTTATTGGGG + Intergenic
1151556273 17:74848225-74848247 AGTCAAAGGAACGTTTCTTGGGG - Intronic
1153892625 18:9532449-9532471 AATCTTAGAAATGCATATTGTGG + Intronic
1154984744 18:21538511-21538533 AGTAATATGAAAGCTTATTTGGG + Intronic
1159735546 18:72093142-72093164 TGTCATAGGTATCCTTTTTGTGG + Intergenic
927548060 2:23972312-23972334 GCTCAAAGGGATGCTTATTGGGG + Intronic
928717813 2:34083054-34083076 ACGCATACGTATGCTTATTGTGG - Intergenic
928813722 2:35262312-35262334 AGTAATGGCAATGCTTATTATGG - Intergenic
929267511 2:39935391-39935413 AGTCACTGGAATGGTTATTTTGG + Intergenic
930168230 2:48224383-48224405 AGTCAAAGGATTGGTGATTGGGG + Intergenic
930471656 2:51823457-51823479 AATAATAGGAATGCATTTTGGGG - Intergenic
932120462 2:69094951-69094973 AGTCAGAGGCATTCTTGTTGGGG - Intronic
933229970 2:79796004-79796026 AGTCATAAGAATGGATATTTAGG + Intronic
937188791 2:120072306-120072328 AGAAATAGGAATGCTTTTTTTGG + Intronic
937822310 2:126324614-126324636 AGTCATAAAAGTGCTTTTTGAGG + Intergenic
940492155 2:154376140-154376162 AGTTAAAGCTATGCTTATTGTGG - Intronic
940703287 2:157073296-157073318 ATGCATATGTATGCTTATTGGGG + Intergenic
943318137 2:186413933-186413955 AGGCATAGGAATGGATATTAAGG - Intergenic
943489934 2:188538647-188538669 ATTCCTAAGAATGCTGATTGCGG + Intronic
947531739 2:230913205-230913227 AGTCATAGGAATGCTTATTGTGG - Intronic
947559951 2:231140549-231140571 AGTCACATGAAAGATTATTGAGG + Intronic
948751162 2:240134148-240134170 AGACACAGGAATGTGTATTGGGG + Intronic
1170386896 20:15829180-15829202 AGTTCTAGGAATGCTTTTTGAGG - Intronic
1177620729 21:23589712-23589734 AGTTATTGGAATGCTTATTTAGG + Intergenic
1178246832 21:30961078-30961100 AGACATAGGTATGCATAATGGGG - Intergenic
951100052 3:18676972-18676994 AGTCAAATGAAGGCTTTTTGAGG - Intergenic
951132007 3:19058097-19058119 AATCATAGGAATCCATATTCAGG - Intergenic
951258255 3:20476495-20476517 ATGCATAAGAATGTTTATTGAGG + Intergenic
954597240 3:51836849-51836871 AGACACAGAACTGCTTATTGAGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955800219 3:62678876-62678898 AGTCATTGGAATGATGACTGGGG - Intronic
957008531 3:74978744-74978766 AATCAGAGGAGTGCTTATTTTGG + Intergenic
957230419 3:77506435-77506457 AGTCATAGGACTGGATATTTAGG - Intronic
958198063 3:90267909-90267931 ATGCACAGGTATGCTTATTGTGG + Intergenic
958733692 3:97986464-97986486 AGTCATAGGCATGTGTATTATGG - Intergenic
960426258 3:117511410-117511432 AGTCAAATGAATACTTTTTGGGG - Intergenic
961710032 3:128820994-128821016 ACTCATAGGAATGCCTGCTGGGG + Intergenic
963206405 3:142640498-142640520 AGTAATATGATTGCTTATTCAGG + Intronic
964380643 3:156095929-156095951 AGGCACAGGTATGTTTATTGCGG - Intronic
967566949 3:190984559-190984581 AGGTGTAAGAATGCTTATTGTGG + Intergenic
967763296 3:193249908-193249930 AGTCATAACAATTTTTATTGAGG - Intronic
970469941 4:16367740-16367762 AGGCATACGTATGTTTATTGTGG - Intergenic
970883351 4:20958121-20958143 TTTCCTATGAATGCTTATTGAGG - Intronic
971553784 4:27986171-27986193 AGTCACAGGATTTCTTATTTTGG - Intergenic
974504319 4:62748543-62748565 ATGCACATGAATGCTTATTGTGG + Intergenic
975093624 4:70432195-70432217 ATGCACAGGTATGCTTATTGTGG - Intronic
975809410 4:78150854-78150876 AATCATTGGATTTCTTATTGAGG + Intronic
977930681 4:102745793-102745815 AGTCATAGGAATGGATATTAAGG - Intronic
978711452 4:111787581-111787603 AGTGATAGAAATGATTATTAGGG - Intergenic
978899372 4:113929128-113929150 AGGCATGGGAATGCATATTAAGG - Intronic
979900627 4:126212513-126212535 ATGCATAGGCATGTTTATTGTGG + Intergenic
981250567 4:142596172-142596194 AGACATGGGAATAATTATTGTGG - Intronic
981289094 4:143053037-143053059 AGGGATAGGAATGCTTGTAGGGG - Intergenic
982383232 4:154772217-154772239 AGGCATACGTATGTTTATTGCGG - Intergenic
982431467 4:155326715-155326737 ATTCATCAGATTGCTTATTGAGG - Intergenic
982555591 4:156859325-156859347 TTTCTTAGGAATGCTAATTGAGG + Intronic
982831784 4:160071144-160071166 AATGAAAAGAATGCTTATTGGGG - Intergenic
983304520 4:165968867-165968889 AGTCAAAGAAATACTGATTGTGG + Intronic
983913889 4:173269869-173269891 AGGAAAAGGAATGCTTCTTGAGG + Intronic
986158688 5:5202953-5202975 AGTCCTAAGAATGATTATTAAGG + Intronic
987180407 5:15361793-15361815 ATGCATAGGTATGTTTATTGCGG + Intergenic
987657413 5:20823925-20823947 AGGCATGGGAATGGATATTGAGG - Intergenic
987903229 5:24040819-24040841 AGATATAAGCATGCTTATTGTGG - Intronic
989808773 5:45646857-45646879 AGTCATAGGTATGTTATTTGAGG + Intronic
990806319 5:59666624-59666646 ATTCATAGGAATGCATAGCGTGG + Intronic
993319546 5:86456307-86456329 AGACATGGGAATGCATATTAAGG + Intergenic
993399158 5:87427357-87427379 AGAAATAGGAATGCTTTTGGTGG - Intergenic
993791491 5:92216631-92216653 AGTCATGGGAATGGATATTAAGG + Intergenic
994291676 5:98034265-98034287 AGGCATAGGAATGGATATTAAGG - Intergenic
995026269 5:107426844-107426866 AGTCATTGGATTTCTTATTCAGG - Intronic
995137229 5:108692852-108692874 AGTCCTAGGAAAGCTGATGGTGG + Intergenic
995322520 5:110852536-110852558 AGTTTTAGGATTGCTTATGGTGG + Intergenic
996282192 5:121743479-121743501 ATTCATAGAAATAGTTATTGAGG - Intergenic
996381864 5:122870652-122870674 AATCATAGGAATGATTCTTTAGG + Intronic
997486579 5:134235998-134236020 AGGCATAGGAATGCATATGAAGG + Intergenic
997814963 5:137007832-137007854 AGGCACACGTATGCTTATTGTGG + Intronic
998290632 5:140910876-140910898 AGGCATAGGAATGGATATTAAGG - Intronic
1002988147 6:2211236-2211258 AGTAAGAGGAATGTTTTTTGGGG + Intronic
1004916592 6:20338616-20338638 AGCCATAGGACTCTTTATTGAGG + Intergenic
1006468126 6:34208328-34208350 AGTCATATGAAGGCTTGATGGGG - Intergenic
1006651513 6:35555450-35555472 TGTCATATGAAAGGTTATTGGGG - Intergenic
1006869825 6:37241479-37241501 AGTTGTAGGAATCCTTACTGAGG - Intronic
1009725923 6:67536070-67536092 AATCAAAGGAATGCTTATGTAGG + Intergenic
1014997438 6:128167665-128167687 AGTCATAGGGAACCTTACTGTGG - Intronic
1015108679 6:129567432-129567454 AGTGATAAGGATGCTTATAGCGG - Intergenic
1015655153 6:135509884-135509906 ATTCACATGTATGCTTATTGCGG - Intergenic
1016147591 6:140695006-140695028 AGGCATAGGAATGGATATTAAGG - Intergenic
1018535296 6:164812766-164812788 AGGCATAGGAATGGATATTAAGG - Intergenic
1018845127 6:167550704-167550726 AGTCAAAGGACGGCTTAGTGAGG - Intergenic
1020895391 7:13932794-13932816 AGTCTCAGGAATGCTTTTAGTGG - Intronic
1021103395 7:16609195-16609217 AGCCATGGGAAGGCTCATTGTGG - Intronic
1028982915 7:96986806-96986828 TGTCCCAGGAATGCTTATTTTGG - Intergenic
1030237831 7:107286058-107286080 AGGCAAAGGAAGGCTTACTGAGG + Intronic
1031442334 7:121809978-121810000 AGAAATGGTAATGCTTATTGGGG - Intergenic
1033815684 7:145069706-145069728 TGTCAAAGGTATGTTTATTGCGG - Intergenic
1035881743 8:3250506-3250528 ATTCATACGTATGTTTATTGCGG - Intronic
1040737370 8:50524902-50524924 ATTCATAGTAATTTTTATTGTGG - Intronic
1043260255 8:78186441-78186463 AGGCATGGGAATGCATATTAAGG - Intergenic
1044286263 8:90414742-90414764 AGGCATAGGAATGGATATTAAGG - Intergenic
1045087945 8:98707781-98707803 TGTAATAAGAAAGCTTATTGTGG - Intronic
1047521657 8:125599607-125599629 GTTCTTAGGAAAGCTTATTGTGG + Intergenic
1050482360 9:6100320-6100342 AGGCATAGGAATGGATATTAAGG + Intergenic
1051850636 9:21503647-21503669 AGTCATAGGAATTATGAATGGGG - Intergenic
1052493957 9:29202793-29202815 GTTCATAGGAATGCTTACTGTGG - Intergenic
1055865840 9:80812141-80812163 AGACATAGGAATGCTTTTCTGGG - Intergenic
1057041337 9:91850009-91850031 ATTCATAGCAATGCTGTTTGTGG - Intronic
1193297501 X:79850403-79850425 AGGCATAGGAATGGATATTAAGG + Intergenic
1193876994 X:86873009-86873031 AGTCATGGGAATGGATATTAAGG + Intergenic
1194443274 X:93958805-93958827 AGGCATAGGAATGGATATTAAGG + Intergenic
1195572545 X:106412697-106412719 ATGCATATGTATGCTTATTGCGG + Intergenic
1196275527 X:113761825-113761847 AGGCATAGGAATGGATATTAAGG + Intergenic
1197404793 X:126036889-126036911 AGGCATGGGAATGATTATTAAGG + Intergenic
1201672329 Y:16537847-16537869 AGTCAAAGGTATGTTTATTTTGG + Intergenic
1202100156 Y:21299140-21299162 AGTCATAGGAATGAATATTAAGG + Intergenic