ID: 947534274

View in Genome Browser
Species Human (GRCh38)
Location 2:230931175-230931197
Sequence GTGGAGATGAAGACTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947534274_947534283 20 Left 947534274 2:230931175-230931197 CCTGGCTCAGTCTTCATCTCCAC 0: 1
1: 0
2: 1
3: 50
4: 383
Right 947534283 2:230931218-230931240 CAAGGAGACGTCATTGCCAATGG 0: 1
1: 0
2: 0
3: 9
4: 101
947534274_947534279 2 Left 947534274 2:230931175-230931197 CCTGGCTCAGTCTTCATCTCCAC 0: 1
1: 0
2: 1
3: 50
4: 383
Right 947534279 2:230931200-230931222 CAAGTCCTCCCGACTCTTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947534274 Original CRISPR GTGGAGATGAAGACTGAGCC AGG (reversed) Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900798279 1:4722716-4722738 GTGGAGATGCAGCCAGAGACTGG - Intronic
900913609 1:5619270-5619292 GTGAAGAGGAAGGCTGAGCCTGG - Intergenic
901039636 1:6356187-6356209 GTGAAGATGAAGGCAGAGACGGG + Intronic
901154658 1:7127405-7127427 GTGCAGATGAAGAGACAGCCTGG - Intronic
902087710 1:13875934-13875956 GTAGAGATGAAGACCGAGATAGG - Intergenic
902098193 1:13963661-13963683 GAGGAGATGATGGCTGAGCTAGG - Intergenic
902465522 1:16615305-16615327 TAAGAGAGGAAGACTGAGCCAGG + Intergenic
902609381 1:17588270-17588292 GGGGAGCTGATGACTGAGCCAGG + Intronic
903006978 1:20305271-20305293 GTGGAAATGCAGGCTGAGCTGGG + Intronic
903106363 1:21083876-21083898 GTGGAGATGAATACTGAATGAGG - Intronic
903644620 1:24887115-24887137 GTGAAGATGAAGGCAGAGACTGG - Intergenic
903656961 1:24955422-24955444 GTGGAGATGAAAACAGACTCAGG - Intronic
903671747 1:25040011-25040033 GCGCAGATGAAGACACAGCCAGG + Intergenic
904778797 1:32929208-32929230 GTGAAGATGAAGGCAGAGACTGG - Intergenic
905133292 1:35777914-35777936 ATGGAGAGAAAGGCTGAGCCTGG - Intergenic
905700290 1:40007823-40007845 GTAGAGATGGAGTCTCAGCCGGG - Intergenic
905799379 1:40833569-40833591 CTGGAGATGGAGACTAGGCCAGG - Intronic
906372166 1:45263353-45263375 GTCAAGATGAAGACAGAGGCAGG - Intronic
907643125 1:56212726-56212748 ATGGAGATGAAGACAAAGCTTGG + Intergenic
908232455 1:62119284-62119306 GATGAGTTGAAGACTGACCCTGG + Intronic
908326903 1:63031918-63031940 GTGAAGATGAAGGCAGAGACCGG + Intergenic
908381791 1:63603804-63603826 GTGGGGACTAAGACTGAGCAGGG + Intronic
908510774 1:64848468-64848490 GTGAAGATGAAGGTGGAGCCTGG + Intronic
908514929 1:64882971-64882993 GGGGAAATGAGAACTGAGCCTGG + Intronic
908581689 1:65523966-65523988 GTGAAGATGAAGGCAGAGACTGG + Intronic
909626559 1:77723426-77723448 TTGGAGATGCAGACTGAGCTAGG + Exonic
910207214 1:84759864-84759886 GTGGAGGGGAAGGCTGAGGCCGG + Intergenic
910803116 1:91164863-91164885 GTGGAGATGAAGGCTGAGACGGG + Intergenic
914291829 1:146281128-146281150 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
914552873 1:148731911-148731933 GTGGAGAGGAAGGCAGAGACTGG - Intergenic
915938979 1:160106506-160106528 ATGGAGGGGAACACTGAGCCAGG - Intergenic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918128872 1:181607798-181607820 GTGGAGATTAGGAATGAGGCTGG + Intronic
918194248 1:182206970-182206992 TTGGAGATACACACTGAGCCTGG + Intergenic
918340372 1:183563506-183563528 GTAGTCATGAAGACTCAGCCCGG - Exonic
919394241 1:197024158-197024180 GTGAGGAAGAAAACTGAGCCAGG - Intergenic
919906509 1:202082216-202082238 GTGGAGATGAAGTCTAGGGCAGG + Intergenic
920029580 1:203028463-203028485 GTGGGGATGAAGGCTCAGCAGGG + Intronic
920778717 1:208967093-208967115 GCAGAGATGAAGATAGAGCCTGG - Intergenic
922110780 1:222553110-222553132 GTGAACATGAAGACAGAGCTTGG - Intergenic
922886159 1:229022592-229022614 GTGGAGATGTAATTTGAGCCTGG + Intergenic
923340988 1:233006917-233006939 GTGGAGATGCTATCTGAGCCTGG - Intronic
924796902 1:247299325-247299347 GTGGAGATGAAGGCAGAGACTGG + Exonic
1062805467 10:416405-416427 GTGGTGCTGAAACCTGAGCCCGG - Intronic
1063466803 10:6251300-6251322 CTGGAGATGACGGCTGAGTCTGG - Intergenic
1063999995 10:11655518-11655540 GTGGGGGTGGAGACAGAGCCAGG - Intergenic
1064293381 10:14055306-14055328 GTGAGGATGAAGACTGCGTCTGG - Intronic
1066204955 10:33179957-33179979 GTGTTGATGACCACTGAGCCAGG - Exonic
1067550823 10:47234720-47234742 GTGGTGATGGAGACAGAGACTGG + Intergenic
1068611871 10:59069251-59069273 GTGAAAAGGGAGACTGAGCCTGG - Intergenic
1069831427 10:71284553-71284575 GTGGCCATGAAGCTTGAGCCAGG + Intronic
1070166335 10:73900956-73900978 CTGGAGATGGAGGCTGAGGCAGG + Intergenic
1070722264 10:78764919-78764941 GTGGAAATGAGGGCTGAGCCTGG - Intergenic
1070995154 10:80772212-80772234 GTGGAGATAAAGACAGGGGCTGG + Intergenic
1071286425 10:84151181-84151203 GTGAAGATGGAGACAGAGACTGG - Intronic
1072270129 10:93768306-93768328 GGAGAGAGGAAGCCTGAGCCTGG + Intronic
1072654214 10:97319345-97319367 GCGGAGCTGAAGACTAAGTCTGG - Exonic
1072907475 10:99467769-99467791 ATGGAGGTGAAGCCTGACCCTGG + Intergenic
1073112710 10:101072125-101072147 CTGGAGCTGAGGACTGGGCCAGG + Intergenic
1074184087 10:111086224-111086246 GGGGAGATGAGGACTGGCCCAGG + Intergenic
1074715480 10:116214522-116214544 ATGGAGTTAAAGGCTGAGCCAGG + Intronic
1075002787 10:118810339-118810361 GTGGTGGTGATGACTCAGCCAGG - Intergenic
1076174017 10:128351730-128351752 GGGGAAGTGAAGACAGAGCCAGG - Intergenic
1076444336 10:130501587-130501609 GTGAAGATGGAGGCAGAGCCTGG - Intergenic
1076522205 10:131088403-131088425 GTGGAGATGAAGGCGGAACGCGG - Intergenic
1077530489 11:3092618-3092640 GGGGGGCTGAAGACTGGGCCAGG - Intronic
1078607088 11:12786227-12786249 GTGGAGATGAATGCTCTGCCTGG + Intronic
1080343814 11:31298355-31298377 GAGGAGAGGAAGACTGGGACAGG - Intronic
1081199686 11:40201182-40201204 GTGAATTTGAAGGCTGAGCCTGG - Intronic
1083301277 11:61740762-61740784 GTGGTGATGTGGACAGAGCCAGG - Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084045554 11:66565941-66565963 GTGGAGTTGGAGTCAGAGCCGGG + Intronic
1084430686 11:69109276-69109298 GTGGAGATTTAGCCTGGGCCAGG + Intergenic
1084659247 11:70537461-70537483 GTGGAGATGAAGTCAGAGACAGG + Intronic
1084726579 11:70946149-70946171 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726606 11:70946258-70946280 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726619 11:70946330-70946352 GTGGAGAGGGAGGCTGATCCTGG - Intronic
1084726648 11:70946439-70946461 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726677 11:70946550-70946572 GTGGAGAGGAAGGCTGACCCTGG - Intronic
1084726684 11:70946586-70946608 GTGGAGAGGGAGGCTGATCCTGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084726762 11:70946877-70946899 GTGGAGAGGGAGGTTGAGCCTGG - Intronic
1084726771 11:70946914-70946936 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1084726781 11:70946951-70946973 GTGGAGAGGGAGGGTGAGCCTGG - Intronic
1085226847 11:74929334-74929356 GGGGAGATGAGGCCTGAGCCAGG - Intronic
1085246984 11:75109671-75109693 GTGGAGAGGATGACTTGGCCAGG - Intronic
1085688454 11:78646943-78646965 GTGGAAATGGAGACTAACCCAGG + Intergenic
1085752111 11:79170596-79170618 GTGAAGATGAAGGCAGAGACTGG + Intronic
1085841701 11:80018704-80018726 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1086184275 11:83994919-83994941 GTGAAGATGAAGACTGAGATCGG - Intronic
1086954055 11:92917309-92917331 GAGGTGATGGAGCCTGAGCCAGG + Intergenic
1087615538 11:100482565-100482587 GTGAAGATGAAGGCAGAGACGGG - Intergenic
1087634520 11:100687486-100687508 CGGGGGAGGAAGACTGAGCCCGG + Intergenic
1089552105 11:119287635-119287657 GTGGAGATCTAGAAAGAGCCAGG - Intronic
1089944467 11:122453983-122454005 GTGGAGATGAGCCTTGAGCCAGG + Intergenic
1091163584 11:133449642-133449664 GTGAAGATGAAGATAGAGACTGG - Intronic
1091201057 11:133781622-133781644 ACAGAGAGGAAGACTGAGCCTGG - Intergenic
1091555803 12:1572640-1572662 GTGGAGAGGAAGGCAGGGCCAGG + Intronic
1091922227 12:4314315-4314337 GAGGTGATGAAGGCTCAGCCTGG + Intergenic
1093800667 12:23367889-23367911 GTGAAGATGGAGACTGTGTCAGG + Intergenic
1094502236 12:31032013-31032035 GTGGAGATAAAGACAGGGCCTGG - Intergenic
1095874901 12:47069388-47069410 GAGGAGATGAAGATGTAGCCAGG + Intergenic
1095978107 12:47953642-47953664 GGAGAGTTGAAGGCTGAGCCAGG - Intergenic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1098146830 12:67506118-67506140 GTGGAGATGAAGGCAGAGATCGG + Intergenic
1099450277 12:82799674-82799696 GTGAAGATGAAGGCTGAGATTGG - Intronic
1099610655 12:84864613-84864635 ATAGAGATTAAGACTGGGCCAGG - Intronic
1102592888 12:113970383-113970405 GTGGAGATGAAGGCTGAGATCGG - Intergenic
1103654702 12:122461069-122461091 GTGGAGATGGAGGCAGAGACTGG - Intergenic
1104400634 12:128473095-128473117 GTGAAGATGAAGACAGAGTCTGG - Intronic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400655 12:128473287-128473309 GTGAAGATGAAGACGGAGGCTGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104400663 12:128473359-128473381 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400673 12:128473455-128473477 GTGCAGATGAAGACAGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400688 12:128473593-128473615 GTGAAGATGAAGATAGAGGCTGG - Intronic
1104400690 12:128473617-128473639 GTGAAGATGAAGACAGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1105408393 13:20150418-20150440 GTGGGGACTAAGACTGGGCCGGG + Intronic
1106505320 13:30366139-30366161 GTGGAGATAAATACGGAGCTGGG + Intergenic
1107513972 13:41111122-41111144 GTGAGGATGAAGGCTGAGGCAGG + Intergenic
1108003363 13:45924500-45924522 GTGGAGGTAAAGAGTGAGGCTGG + Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1109209884 13:59523032-59523054 CTGGAAATGAAGACTCAGGCAGG - Intergenic
1109233095 13:59782943-59782965 GTGAAGGTGAAGAGAGAGCCGGG + Intronic
1110563603 13:76935932-76935954 GTGGAGATGATGAATAAGCACGG - Intergenic
1114035900 14:18626947-18626969 AGGGGGAGGAAGACTGAGCCCGG - Intergenic
1114122737 14:19688075-19688097 AGGGGGAGGAAGACTGAGCCCGG + Intergenic
1114851001 14:26382383-26382405 GTGGAGAGAATGATTGAGCCTGG - Intergenic
1115131569 14:30058556-30058578 TTGCAAATGAATACTGAGCCAGG - Intronic
1115462397 14:33676067-33676089 TTGAAGATGAAGACAGAACCAGG + Intronic
1117733067 14:58743380-58743402 TTGGAGATGAAGACTTTGCAAGG + Intergenic
1119897422 14:78231996-78232018 ATGGGGGTGAAGGCTGAGCCTGG - Intergenic
1120010565 14:79408748-79408770 TTAGGGATGAAGAATGAGCCTGG - Intronic
1121523142 14:94599891-94599913 GGGGAGGTGGAGGCTGAGCCAGG + Intronic
1121929911 14:97963061-97963083 GTGGAGATCAGGACTTGGCCTGG + Intronic
1122325298 14:100878062-100878084 GAGGAGCTGAGGACAGAGCCAGG - Intergenic
1122365123 14:101190504-101190526 GTTGTGATGAAGACTGAGCAAGG - Intergenic
1122519300 14:102332199-102332221 GTGGAGAAGCACAGTGAGCCGGG - Intronic
1123922864 15:25082747-25082769 GTGGGCATGAAGACTGTGCATGG + Intergenic
1124051021 15:26197686-26197708 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1124051032 15:26197737-26197759 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1127321672 15:57852707-57852729 GTGAACATGAAGACTAAGCTGGG + Intergenic
1127328653 15:57918317-57918339 GAGGAGATGATGCCTGAGCTGGG - Intergenic
1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG + Intergenic
1129522503 15:76194716-76194738 GTGCAGATGAAGGCAGAGCAGGG - Intronic
1131389348 15:92034402-92034424 GTGGAGACGATGAGTGTGCCTGG + Intronic
1131723040 15:95192062-95192084 ATGGAAATAAAGACTGAGCCAGG + Intergenic
1132069795 15:98766081-98766103 GTGTGGATGAAGGGTGAGCCGGG + Intronic
1132997927 16:2833017-2833039 GGGGACATGAAGAATGGGCCAGG - Intronic
1134324163 16:13191773-13191795 GTGGAGATGAAGAATGTCCCTGG + Intronic
1134388125 16:13793510-13793532 AGGGAGATGAAGCCTGATCCAGG - Intergenic
1134666830 16:16024833-16024855 GTAGAGAGGGAGGCTGAGCCAGG + Intronic
1135611181 16:23868755-23868777 GTGGGGATGGAGACTGGGGCCGG + Intronic
1135920576 16:26645535-26645557 GGGGAGATGCAGACAGAGCTAGG + Intergenic
1136617520 16:31407693-31407715 AAGGAGATGCAGGCTGAGCCTGG - Intronic
1138982656 16:62288825-62288847 GTATAGATATAGACTGAGCCAGG - Intergenic
1141175858 16:81718759-81718781 ATGAGGATGAAGACAGAGCCTGG + Intergenic
1141630901 16:85287447-85287469 GAGGAGATGAAGCCAGAGGCGGG - Intergenic
1141650928 16:85392807-85392829 GTGAAGATGGAGCCTGAGGCTGG + Intergenic
1142203684 16:88772842-88772864 GGTGACATGAAGACTGAGCCAGG - Intronic
1142390920 16:89799227-89799249 GTGCAACTGAAGACAGAGCCAGG + Exonic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142604389 17:1073562-1073584 GTTCAGTGGAAGACTGAGCCTGG - Intronic
1142877386 17:2860086-2860108 CTGGACATGAGGACTGTGCCTGG + Intronic
1143202167 17:5120669-5120691 GTGAAGATGGACACTGTGCCTGG + Exonic
1143252038 17:5530525-5530547 CTGGACATCAAGGCTGAGCCTGG - Exonic
1143473278 17:7189726-7189748 GAGTTGGTGAAGACTGAGCCTGG - Intergenic
1143589641 17:7874588-7874610 GTAGAGATAAAGAATTAGCCAGG + Intronic
1144095620 17:11898033-11898055 GTGAAGATGGAGACAGACCCTGG - Intronic
1144381424 17:14702376-14702398 GTGGAGATGTAGCTAGAGCCAGG + Intergenic
1144554645 17:16271254-16271276 GTGGAGCTGAGGACTGATCCTGG - Intronic
1144627254 17:16850489-16850511 GTGAAGATGGACACTGTGCCTGG - Intergenic
1144879185 17:18422223-18422245 GTGAAGATGGACACTGTGCCTGG + Intergenic
1145088932 17:19970171-19970193 GGGAAGATGAAGACTGAGGTAGG - Intronic
1145153050 17:20522164-20522186 GTGAAGATGGACACTGTGCCTGG - Intergenic
1146530547 17:33604360-33604382 GTGGTGATGAAGTGTCAGCCTGG + Intronic
1146683666 17:34826225-34826247 GTGGAGATGAATACTTACACAGG - Intergenic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147542619 17:41373315-41373337 GAGGGGCTGAAGAATGAGCCAGG + Intronic
1147581392 17:41629173-41629195 GTGAAGATGGACACTGTGCCTGG - Intergenic
1148167524 17:45493639-45493661 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1148517570 17:48235093-48235115 GAGGAGACAAAGACTGAGCTGGG + Intronic
1148789759 17:50166579-50166601 GAGGAGAGGAAGACGGGGCCAGG - Intronic
1149498953 17:57136729-57136751 GTGGAGATAAAGCCACAGCCAGG + Intergenic
1150398705 17:64840052-64840074 GGGGAGCTGAAGACTGAGCAAGG + Intergenic
1152296019 17:79467343-79467365 GTGGAGATGAGGGCAGAGCGGGG + Intronic
1152569360 17:81114940-81114962 GTGGACATGAAGACGCAGCAGGG - Intronic
1152743448 17:82028632-82028654 GAGAAGATGCAGACAGAGCCTGG + Exonic
1153345150 18:4017674-4017696 GTGAAGTTTAAGGCTGAGCCAGG - Intronic
1156328156 18:36093334-36093356 GTGGAAGTGAAGAGTGAACCAGG + Intergenic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1157211831 18:45749435-45749457 GTGGACATGAAGACTGGTCAGGG + Intronic
1157696188 18:49725816-49725838 CTGGGGATGGAGACTGAGCCAGG - Intergenic
1158212779 18:55069205-55069227 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1158437957 18:57447267-57447289 GTGGTGCTGAAGCCTGCGCCGGG - Intronic
1158634945 18:59148202-59148224 GTGAAGAGGAAGATTGAGGCAGG + Intronic
1158692875 18:59676980-59677002 GTGGAGAGGAAGACAGGGGCCGG + Intronic
1159914916 18:74180313-74180335 GTGAAGATGAAGGCGGAGACTGG + Intergenic
1160042882 18:75361224-75361246 GAGGACATGAAGACAGAGCGTGG - Intergenic
1160569475 18:79807080-79807102 GTGGAGGAGAAAACTGACCCCGG + Intergenic
1161095829 19:2390043-2390065 GTGGAGATGAAGGCTGCCCTAGG + Intronic
1161127165 19:2564637-2564659 GTGGAGATGGAGGCAGAGACTGG + Intronic
1161407008 19:4096297-4096319 GGCGAGATGATGACGGAGCCAGG - Intronic
1162064029 19:8114070-8114092 GTGAAGATGGAGACAGAGACTGG + Intronic
1162877002 19:13627846-13627868 GTGGAGATGAAGCTTGGGCAGGG - Intergenic
1163284486 19:16338002-16338024 GTGGAGGTGATGCCGGAGCCAGG - Intergenic
1163758392 19:19120288-19120310 CTGGAGATGGAGTCTGAGACAGG - Intronic
1166226866 19:41401398-41401420 GTGGAGATGAAGAAATAGTCAGG + Intronic
1166231493 19:41427663-41427685 GTGGGGCTGAAGGCTGGGCCTGG + Intronic
1166372633 19:42310593-42310615 GGGGTGATGAAGGCTGAGGCAGG - Exonic
1166919890 19:46222017-46222039 AGGGAGATGATGACAGAGCCAGG - Intergenic
1167422318 19:49411621-49411643 GTCAAGGGGAAGACTGAGCCAGG + Intronic
1167422441 19:49412241-49412263 ATGGTGATGAAGCCTGAGCCAGG + Intronic
1167751878 19:51385775-51385797 CTGGAGAGGTAGACTGAGGCAGG - Intronic
927554207 2:24021255-24021277 GTGGGGAGGAAGACAGATCCAGG - Intronic
928786216 2:34888920-34888942 GTGTAGATGCAGATTGAACCTGG + Intergenic
929544631 2:42847671-42847693 GTGGAGGTGATAGCTGAGCCCGG - Intergenic
931322570 2:61185498-61185520 CTGGAGATGAGGCCTGAACCTGG - Exonic
931787005 2:65629194-65629216 GTGAAGATGAAGGCAGAGACTGG - Intergenic
932777311 2:74535978-74536000 GTAGAGAGGATGACTGACCCTGG + Exonic
934475714 2:94592081-94592103 GTGGTGATGAGGAAGGAGCCAGG + Intronic
935381261 2:102453096-102453118 GGGGAGATGCAGTCTGTGCCAGG + Intergenic
936053965 2:109246751-109246773 GTGGAGATGATACCTGAGCCTGG + Intronic
938274494 2:130006007-130006029 CGGGAGAGGAAGACTGAGCCCGG + Intergenic
938400883 2:130990664-130990686 GAGGAGATGGAGATTCAGCCTGG + Intronic
938440877 2:131331268-131331290 CGGGAGAGGAAGACTGAGCCCGG - Intronic
939641957 2:144650980-144651002 TTGGAGCTCAACACTGAGCCTGG - Intergenic
940643021 2:156366943-156366965 GTTGAGAAGTAGACTGATCCAGG - Intergenic
942528993 2:176888057-176888079 GAGGAGCTGAAAACTGAGGCAGG + Intergenic
945642094 2:212443228-212443250 GTGGAGATGAAAAGTGATCAAGG - Intronic
945984270 2:216341427-216341449 CTGCTGATGCAGACTGAGCCTGG + Intronic
946255449 2:218438516-218438538 GAGGATATGAAGGCTGAGGCTGG - Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
947069422 2:226270465-226270487 GTGCAGATGGAGACAGAGACTGG + Intergenic
947534274 2:230931175-230931197 GTGGAGATGAAGACTGAGCCAGG - Intronic
948398079 2:237662177-237662199 GTGGAGACGGAGGCAGAGCCTGG - Intronic
949042563 2:241856054-241856076 GCAGAGATGAAGGCAGAGCCTGG + Intronic
949071177 2:242025201-242025223 GTGGAGCTGGAGACTGAGGGAGG + Intergenic
1168939607 20:1697446-1697468 GTGGAGATTAAGTCTGGACCAGG - Intergenic
1169084392 20:2817603-2817625 TTGGGGATGCAGACTGAGGCAGG - Intronic
1169973275 20:11294877-11294899 GTGGAGAAGAGGACAGAGTCTGG - Intergenic
1173183548 20:40821968-40821990 GTGGAGATGAAGAATGCCCCAGG - Intergenic
1173414915 20:42846765-42846787 GTTGAGATAAGGACTGGGCCTGG + Intronic
1173684176 20:44910968-44910990 GTGGAGAGGATGAGTGAGCTTGG + Intronic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174153680 20:48503324-48503346 GTGGAGATGCAGACCCAGGCAGG - Intergenic
1174500472 20:50980708-50980730 CTGGAGATGTGGAGTGAGCCGGG + Intergenic
1174532434 20:51224762-51224784 GTGAAGATGGAGGCAGAGCCTGG + Intergenic
1174560165 20:51425462-51425484 GTGCTGATGAGAACTGAGCCAGG - Intronic
1175257656 20:57656847-57656869 GGGGGGATGTAGACTGGGCCCGG + Intronic
1176106857 20:63393523-63393545 GTGGAGGTGCAGGCTGGGCCTGG + Intergenic
1177871079 21:26573248-26573270 GCGGAGATGAAATGTGAGCCTGG - Exonic
1178110210 21:29362801-29362823 GTGGAGAGGAAGGCAGAGACTGG + Intronic
1179540738 21:42082029-42082051 GAGGAGATGAAGAGTGAGTCAGG + Intronic
1179838694 21:44055840-44055862 AGGGAGAAGAGGACTGAGCCAGG + Exonic
1180046353 21:45307557-45307579 GACGAGAGGAAGACGGAGCCGGG + Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180460023 22:15554001-15554023 AGGGGGAGGAAGACTGAGCCCGG - Intergenic
1180709651 22:17831166-17831188 GGGGTGGTGAAGACGGAGCCAGG - Intronic
1181094821 22:20497710-20497732 GTAGAGACGAAGACTGAGTAGGG + Intronic
1181486206 22:23233261-23233283 GTGGAGATGCTGCCAGAGCCTGG - Intronic
1182324793 22:29504368-29504390 GTGGAGAGAAATACTTAGCCAGG + Intergenic
1182901275 22:33900298-33900320 GTGGAAACGTAGAGTGAGCCGGG - Intronic
1183091392 22:35524663-35524685 GTGGCCATGAAGACTGAGGCTGG + Intergenic
1183480877 22:38064903-38064925 GTAGAGTGGAAGACAGAGCCAGG + Intronic
1183682269 22:39339341-39339363 GTAGAGCTGAAGAATGAGCTGGG - Intergenic
1184252578 22:43269155-43269177 TTGGAGAAGAAGACACAGCCCGG - Intronic
1184561146 22:45263630-45263652 GTGGAGCAGAAGAAGGAGCCGGG - Intergenic
1184819345 22:46897463-46897485 ATGCAGATGAAGACTTGGCCTGG + Intronic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1185170646 22:49291765-49291787 GTGGGGATGGAGACAGAGACTGG - Intergenic
949680204 3:6504901-6504923 CTGCAAATGAAGACTGAGCCAGG - Intergenic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
950849879 3:16052226-16052248 GAGGAAATGAGGACAGAGCCTGG - Intergenic
952252518 3:31668612-31668634 CTGGAGAGGAAGACACAGCCCGG + Intronic
952419049 3:33114700-33114722 GTTGAGATGAAGAAGGAGACAGG - Intronic
953023651 3:39132291-39132313 GTGGAGCTGAGATCTGAGCCAGG + Intronic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
955113986 3:55978625-55978647 GTTGAGATGCACACTGAGCGTGG - Intronic
955554768 3:60125173-60125195 ATGGAGATGAAGAGCCAGCCAGG + Intronic
956171840 3:66439071-66439093 GAGGAGAGGAAGACAGAGCAGGG + Intronic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
961059237 3:123814267-123814289 GGGGACATGAAGCCTGAGCTTGG - Intronic
961713798 3:128845784-128845806 GTGGGGCTGAAGCCAGAGCCCGG - Intergenic
962042406 3:131720773-131720795 GTGGAGAGGAAAAGTGAGACAGG - Intronic
962124093 3:132596480-132596502 CTGCAGGTGGAGACTGAGCCTGG + Intronic
962404259 3:135086630-135086652 GTGGAGATGACAACTGATGCAGG - Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
963990337 3:151646076-151646098 GTGAAAATAAAGACTGACCCTGG - Intergenic
964292795 3:155199945-155199967 GTGAAGATGAAGGCAGAGACTGG + Intergenic
964406996 3:156359569-156359591 CAGGAGATCAAAACTGAGCCAGG + Intronic
965394163 3:168142011-168142033 TAGGAGATGGAGACTGATCCTGG - Intergenic
967416075 3:189219970-189219992 GTGAAGTTGAAGAGTCAGCCTGG + Intronic
967646317 3:191928371-191928393 GTGGATATGATGACTTAGCTTGG + Intergenic
969523990 4:7694976-7694998 GTGCAGGTGAACACAGAGCCAGG - Intronic
969819842 4:9711396-9711418 GTGGAGCTGAAGCATGAACCAGG + Intergenic
970189633 4:13501437-13501459 GTGCAGATGGAGACAGAGACTGG - Intergenic
970940407 4:21626275-21626297 GTGGAGATGAAGACTTTGGGAGG + Intronic
972405002 4:38737104-38737126 GTGAAGATGAAGGCAGAGACTGG + Intergenic
974106513 4:57475539-57475561 TGGGAGATGAATACTGAGCAAGG + Intergenic
974895669 4:67935247-67935269 GTGGTGTTGAAGATGGAGCCAGG - Intronic
975373146 4:73611192-73611214 GTAGAGATGAAAACTGAAACTGG - Intronic
976035236 4:80810554-80810576 GTGAAGATGAAGGCAGAGACTGG + Intronic
983029715 4:162784723-162784745 CTGGAGATGAAGTCTGAGGGAGG + Intergenic
984493001 4:180459001-180459023 GTGGAAATGGAGGCAGAGCCTGG - Intergenic
984805137 4:183745260-183745282 GTGGAGGTGAAGACAGAGAATGG - Intergenic
984970376 4:185183512-185183534 GTGGATATGAATGCAGAGCCAGG - Intronic
985956780 5:3271638-3271660 GTGAAGATGAAGGCAGAGACGGG + Intergenic
986483942 5:8216939-8216961 GTGGGGGTGGAGACTTAGCCAGG - Intergenic
986741981 5:10712508-10712530 GTGCAGAGGAGGACTGAGCACGG + Intronic
988922767 5:35960343-35960365 GTGGAATAGAAGACTGAGCCCGG + Intronic
989476487 5:41880240-41880262 GAGGAGATGAAGACTGAACAAGG + Intergenic
989596129 5:43157842-43157864 GTGAAGATGAAGGCAGAGACTGG - Intronic
991207954 5:64071481-64071503 GTGGAGATGGAGGCAGAGACTGG + Intergenic
991354617 5:65754887-65754909 GTAGAAAGGAAGACTGAACCAGG - Intronic
992472310 5:77070127-77070149 GTGGACAAGAAGACTGAGTCAGG + Intergenic
993034564 5:82742842-82742864 ATGGAGATTAAAACTAAGCCAGG + Intergenic
997213615 5:132093166-132093188 GTGGAAATGAGGACTGAAACAGG + Intergenic
997612407 5:135224441-135224463 GTGGAGATGAGGCCTGATTCGGG + Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
999409965 5:151342205-151342227 GTGGAACTGAAGAAGGAGCCAGG - Intronic
999823920 5:155256128-155256150 GTGAAGATGAAGACAGAGATCGG - Intergenic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000301350 5:159959235-159959257 GAGGAGATGAAAACCGAGCTGGG + Intronic
1001915088 5:175553631-175553653 TTAGAAATGAAGACTGAGGCTGG + Intergenic
1002926526 6:1608843-1608865 GTGGAGATGGAGACTGGCCTGGG + Intergenic
1003340293 6:5214069-5214091 GTGGAGATGATGACAGCGACAGG + Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1004346941 6:14857447-14857469 AGGGAGATGAAGCCTGACCCTGG - Intergenic
1004505333 6:16242561-16242583 GTGGAGATGAAGGCAGAGATTGG - Intronic
1006099370 6:31676641-31676663 GTGGAGGTGAAGGCTGAGGGAGG - Intergenic
1007303147 6:40883796-40883818 GTGAAGATGAAGGCAGAGCTGGG - Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007808035 6:44465339-44465361 GTGAAGATGAAAACAGAGACTGG - Intergenic
1008460381 6:51763201-51763223 ATGGATATGAAAACTGAGGCTGG - Intronic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1009474154 6:64067028-64067050 GTGGGGATGAAGAATGAGATTGG - Intronic
1009883178 6:69594939-69594961 GTGGAGATGAGGGCAGAGACTGG - Intergenic
1012552993 6:100481372-100481394 GATGAGATGAAGACTCAGGCAGG - Intergenic
1013499828 6:110737855-110737877 TTGGAGTTGAAGACTCAGCATGG - Intronic
1015300754 6:131650768-131650790 GTGAAGATGAAGGCAGAGCCTGG - Intronic
1015589647 6:134810693-134810715 GTGAAGATGAAGACAGAGATGGG + Intergenic
1015835136 6:137412746-137412768 GTGGAAGTGAGGTCTGAGCCAGG - Intergenic
1016062826 6:139648022-139648044 GTGAAGATGAAGGCAGAGCTCGG + Intergenic
1016397654 6:143642714-143642736 GTGAAGATGAAGACAGAGATTGG + Intronic
1017009836 6:150055783-150055805 GTGGAGCTGAAGACTCAGGGAGG - Intergenic
1018082492 6:160270521-160270543 GTGGAGATGCAGGCAGAGGCTGG + Intronic
1019100436 6:169625430-169625452 GTGGTGGTGGAGACTGAGCCTGG + Intronic
1019570496 7:1709348-1709370 AAGGAGATGGAGACAGAGCCAGG + Intronic
1019825213 7:3279047-3279069 GAGGAGATGAGGACAGTGCCGGG + Intergenic
1020741741 7:12028562-12028584 GTGAAGATGGAGGCTGAGACTGG + Intergenic
1020831985 7:13103925-13103947 GTGAAGATGAAGACAGAGATTGG + Intergenic
1022425803 7:30267545-30267567 GGGGAGAAGGAGACTGAACCAGG + Intergenic
1027848516 7:83418398-83418420 GTGGAGATGAAGGAGGAGCTGGG + Exonic
1029333166 7:99877067-99877089 GTGGAGATAAAGAGTGTGACTGG + Intronic
1030051129 7:105538563-105538585 GTGGGGCTGAAGACTCAGCCAGG - Intronic
1030893841 7:115031888-115031910 GAGGAGATGAAGAATGAACTTGG + Intergenic
1034339965 7:150346602-150346624 GTGGAGATGTTGACTGAACAGGG + Intergenic
1034542428 7:151767111-151767133 GTGAAGATGAAGGCGGAGACTGG + Intronic
1035339738 7:158152588-158152610 GTGGAGATGGAGCCCCAGCCAGG - Intronic
1035444693 7:158932313-158932335 GAGGAGGCAAAGACTGAGCCAGG + Intronic
1035814874 8:2528289-2528311 GCTGAGATGAAGACAGATCCGGG - Intergenic
1036687623 8:10922439-10922461 GTGGAAGTGAGCACTGAGCCTGG - Intronic
1038422745 8:27443820-27443842 GAGGAGATGAACGCTGAGCCAGG - Intronic
1039575067 8:38616514-38616536 GTGTAGCTGAAGACAGAGCAAGG - Intergenic
1041118803 8:54565984-54566006 GTGAAGATGAAGGCAGAGACAGG - Intergenic
1042227894 8:66528921-66528943 GTGGGGATGAAGGCTGGGCATGG + Intergenic
1042711266 8:71719975-71719997 GTGGACATGAAGTCGGAGGCGGG + Intergenic
1044727526 8:95205414-95205436 GAGGAGGTGATGACTAAGCCAGG + Intergenic
1045026900 8:98096304-98096326 GTGGATATGTAGACTGAGCGTGG - Intergenic
1045074155 8:98543888-98543910 GAGAAGATGAACACTGAGACTGG + Intronic
1045548335 8:103148233-103148255 GTGGAGATGAAGGCAGAGACCGG + Intronic
1046646751 8:116793853-116793875 GTGGAGATGCAGCCTTGGCCAGG - Intronic
1047471665 8:125179790-125179812 GAGGAGGTGAAGACTGAGTGGGG - Intronic
1048020402 8:130533211-130533233 GTGAAGATGAAGGCAGAGACTGG + Intergenic
1048432145 8:134380547-134380569 GTGGAGATTAAGGATGGGCCTGG + Intergenic
1048861387 8:138726789-138726811 GGGCAGATGGAGGCTGAGCCAGG + Intronic
1050811332 9:9751667-9751689 GTGAAGATGAAGACAGAGATTGG + Intronic
1052854343 9:33397836-33397858 GTGGTGATGAGGAAGGAGCCAGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053417174 9:37953987-37954009 CTTGAGATGAAGGCTGAGTCTGG + Intronic
1053503784 9:38622425-38622447 GTGGAGAGGAAGAGTAAGGCGGG + Intergenic
1053682351 9:40493997-40494019 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1053932332 9:43122323-43122345 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054281363 9:63130932-63130954 GTGGTGATGAGGAAGGAGCCAGG + Intergenic
1054295449 9:63329497-63329519 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054393468 9:64634001-64634023 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054428118 9:65139215-65139237 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054502261 9:65882329-65882351 GTGGTGATGAGGAAGGAGCCAGG + Intronic
1054627473 9:67412993-67413015 GTAAAAATGAGGACTGAGCCTGG + Intergenic
1054739434 9:68789761-68789783 CAGTAGAGGAAGACTGAGCCTGG - Intronic
1056676771 9:88682665-88682687 CTGGAGGTGAAGACGAAGCCAGG + Intergenic
1059453254 9:114383905-114383927 GTAGAGAGGAAGACTGGGCGGGG - Intronic
1060070686 9:120544474-120544496 CTGGAGAAGAAGCCTGGGCCTGG + Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1062440208 9:136566357-136566379 GGAGGGATGAAGACTGAGGCAGG + Intergenic
1185452094 X:288062-288084 GTGGAGATGGAGGCAGAGACTGG - Intronic
1185455693 X:309628-309650 GTGGAGATGGAGGCAGAGACTGG + Intronic
1185499778 X:587934-587956 GTGGAGATGGAGGCAGAGACTGG - Intergenic
1185561132 X:1061369-1061391 GTGGAGATGGAGGCAGAGACTGG - Intergenic
1185561192 X:1061713-1061735 GTGGAGATGGAGGCAGAGACTGG - Intergenic
1185614770 X:1414131-1414153 GTGGAGATGGAGGCAGAGACTGG + Intronic
1185629045 X:1502805-1502827 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185629103 X:1503132-1503154 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185690797 X:2153775-2153797 GTGGAGATGGAGGCAGAGACTGG + Intergenic
1185691132 X:2156041-2156063 GTGAAGATGGAGACAGAGACGGG - Intergenic
1185704969 X:2260108-2260130 GTGGAGATGGAGGCAGAGACTGG - Intronic
1185758684 X:2672922-2672944 GTGGAGATGGAGGCAGAGACTGG + Intergenic
1185818866 X:3182594-3182616 GGGGAGATGAAGGCTGAGATAGG + Intergenic
1186067671 X:5783607-5783629 GTGGAGATGGAGCCAGAGACTGG - Intergenic
1186138848 X:6549446-6549468 GTGGTGATGAAGGCAGAGACTGG + Intergenic
1187495039 X:19788352-19788374 GTGAAGATGAAGACAGAGACTGG + Intronic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1191921651 X:66263034-66263056 AGGGAGAGGAAGACTGAGCCAGG + Intronic
1192497149 X:71623416-71623438 GGGGAGATGAAGTTTGAGCTGGG + Intergenic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1195048772 X:101078599-101078621 GGGGAGATGAAAAGTGAGCCCGG + Intergenic
1195801973 X:108722824-108722846 GTGGAGCCCAAGAGTGAGCCAGG + Intronic
1199943279 X:152645372-152645394 GAGGAGATTAAGACTCAGCAGGG + Intronic
1200182353 X:154158468-154158490 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200188007 X:154195582-154195604 GTGAAGATGAAGGCAGAGACTGG - Intergenic
1200193657 X:154232722-154232744 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200199412 X:154270526-154270548 GTGAAGATGAAGGCAGAGACTGG - Intronic
1200223371 X:154403102-154403124 CTGGAGCTGCGGACTGAGCCAGG - Exonic
1201261468 Y:12162972-12162994 GGGGAGATGAAGGCTGAGATAGG - Intergenic
1201268004 Y:12227544-12227566 GCGGAGATGAGGACAGAGACTGG + Intergenic
1201268047 Y:12227940-12227962 GTGGAGATGGAGGCAGAGACTGG + Intergenic
1201280668 Y:12339459-12339481 GTGGAGATGGAGTCAGAGACAGG - Intergenic
1201652676 Y:16307676-16307698 ATTGAGATTGAGACTGAGCCTGG + Intergenic