ID: 947536211

View in Genome Browser
Species Human (GRCh38)
Location 2:230941861-230941883
Sequence ATCTTACATTGTAAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947536211 Original CRISPR ATCTTACATTGTAAGATCTA AGG Intronic
900847245 1:5113795-5113817 AGCTGACTTTGTAAGATCTGAGG - Intergenic
908237324 1:62159053-62159075 ATTTTACATGCTAAGATTTAAGG - Intronic
908689543 1:66762687-66762709 TTCTTAAATCGTAAGATTTATGG + Intronic
910249744 1:85184506-85184528 ATCTTGCATTGTTACATGTAGGG - Intronic
910478157 1:87630408-87630430 ATCTTACCTTGAAAAAACTAGGG + Intergenic
911541984 1:99167601-99167623 ATCATACTTTGTAAGTGCTAAGG + Intergenic
912761941 1:112375784-112375806 ATATTACATTGTATTATCTAGGG - Intergenic
917239133 1:172928478-172928500 ATATCACACTGTATGATCTAAGG - Intergenic
917551452 1:176034992-176035014 ATATTATATTGTAAGATGTTGGG - Intronic
918389329 1:184041454-184041476 ATTTTACATTGTAGGATTTTAGG - Intergenic
919069429 1:192735091-192735113 ATCATACATTTTAAAATCAATGG + Intergenic
919979727 1:202635351-202635373 ATCATCCCTTGTAAGTTCTATGG - Intronic
923332686 1:232940147-232940169 CCCTTACATTTGAAGATCTAAGG - Intergenic
923512551 1:234664923-234664945 TTATTACATTGTAATATATAAGG - Intergenic
1063179549 10:3585448-3585470 TTCTTTCCTTGTAAGATCTCTGG + Intergenic
1063937689 10:11095927-11095949 ATGTTACACTGTAAATTCTAAGG - Intronic
1064828960 10:19440356-19440378 ATATTACACTTTAAGTTCTAGGG + Intronic
1065504167 10:26412737-26412759 ATCTTACAAGCTAAGATCTTGGG - Intergenic
1068624853 10:59232026-59232048 ATCTTAGATTGTAACACATAGGG - Intronic
1070063543 10:73010445-73010467 ATCTTACATAGCAAGATGGAGGG + Intronic
1072297443 10:94024588-94024610 ATCTTACCTTCTAAACTCTATGG + Intronic
1072940114 10:99755408-99755430 ATCTGGAATTGTAAGTTCTAAGG - Intronic
1073531987 10:104240544-104240566 TTCTCACATTGAAAGATTTATGG + Intronic
1074735560 10:116428662-116428684 TCCTTACATTGTAATGTCTAAGG - Intronic
1077400879 11:2356454-2356476 TTATTACATTGTAATATGTAAGG - Intergenic
1079442564 11:20529859-20529881 CCCTCACATTGTAAGATCTTAGG - Intergenic
1081265076 11:41010894-41010916 CTCTTACTTTGTCAGATGTAAGG + Intronic
1083499782 11:63093830-63093852 AACTTACATTTTAAGTTCAAGGG - Intronic
1087148748 11:94838698-94838720 AATTTACAAAGTAAGATCTAGGG - Intronic
1087398405 11:97632980-97633002 ATATTATATTTTAAGTTCTAGGG + Intergenic
1088320570 11:108550884-108550906 ATCTTCCAGTCTAAAATCTATGG + Intronic
1090144549 11:124307342-124307364 ATCTTACATTGTCAGAGGTCAGG - Intergenic
1090461290 11:126893861-126893883 TTCTTAGATTGTAAGTTCTCAGG + Intronic
1092074564 12:5662311-5662333 CTCTTAAGTTGTAGGATCTAAGG - Intronic
1092916104 12:13190618-13190640 AACTTTCATTGGAAGATCCAAGG - Intergenic
1093273125 12:17090817-17090839 ATAGTACATGGTAATATCTATGG - Intergenic
1093850241 12:24027662-24027684 ATCTTACATGGTAAGTTGAAAGG - Intergenic
1094014988 12:25853020-25853042 ATCTTACAATGGAAGGTCTGTGG + Intergenic
1094673454 12:32594474-32594496 TTATTACATTGTAATATGTAAGG - Intronic
1097709273 12:62900515-62900537 TTATTACATTTTAAGTTCTAGGG - Intronic
1099265762 12:80445588-80445610 ATCTTACATTGTCAAATATAAGG + Exonic
1104570353 12:129919533-129919555 GTCCTTCATTGTCAGATCTAAGG + Intergenic
1106924371 13:34598741-34598763 AACTTACATTGTAATATGTAAGG + Intergenic
1109225260 13:59686352-59686374 TTCTTACAGTGTAAGATAAAAGG - Intronic
1109372314 13:61439393-61439415 TTCTTAAATGGTAATATCTATGG + Intergenic
1109481344 13:62958957-62958979 ATATTACATTATAAAATTTATGG + Intergenic
1110430560 13:75418100-75418122 ATCTAACATTTTATGATCTCAGG - Intronic
1111895578 13:94137666-94137688 ATTTTAGATTGTAAGCTCAATGG - Intronic
1114007133 14:18326134-18326156 ATCTTACATATTAAGATGAATGG - Intergenic
1114142166 14:19925598-19925620 AGCTTAAATTGTGAGATCTCAGG - Intergenic
1115175124 14:30553567-30553589 AACTTTCATTCTAAGATCTCAGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119066780 14:71536033-71536055 ATGCTACATTGTAAAATCTAAGG + Intronic
1120190809 14:81437549-81437571 AACTTACATTGTAGGACCTTTGG + Intergenic
1120319215 14:82937311-82937333 AACTTATATTTTAAGTTCTAGGG - Intergenic
1123391050 15:19872776-19872798 ATCTTACATATTAAGATGAATGG - Intergenic
1123823701 15:24059416-24059438 ATCCTACATTGTAAACTCTAAGG - Intergenic
1123965586 15:25453718-25453740 TTATTACATTGTAACATATAAGG - Intergenic
1128985429 15:72217136-72217158 ATCTTCCTTTGTAAAAGCTAAGG + Intronic
1130003891 15:80075433-80075455 ATCTTACATTGACAGATTTAGGG + Intronic
1130221960 15:82027084-82027106 GTCTTACCTTGTAAGACCTCTGG - Intergenic
1130222099 15:82028316-82028338 GTCTTACCTTGTAAGACCTCTGG + Intergenic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1132593863 16:739350-739372 ATCTTACATGGTTAGAACTAGGG + Intronic
1133492313 16:6282237-6282259 ATCTTAAAGTGAAAAATCTAAGG + Intronic
1137006027 16:35275046-35275068 TTCTTACACTTTGAGATCTAGGG + Intergenic
1144448055 17:15349591-15349613 ATCTGACATTTTAAGATCTGAGG + Intergenic
1145115178 17:20203310-20203332 ATTTTACACTGTAACATCTGAGG + Intronic
1145408380 17:22631632-22631654 ATTTTAAGTTGTAAGATCTGAGG + Intergenic
1153398875 18:4659276-4659298 ATAGTATATTGTAAGAACTATGG - Intergenic
1153780277 18:8489154-8489176 TTCTTACATAGTTAAATCTATGG + Intergenic
1154530330 18:15337881-15337903 ATCTTACATATTAAGATGAATGG + Intergenic
1155428448 18:25730084-25730106 ATGTTACATTTTAAAATCTGTGG - Intergenic
1156009605 18:32481363-32481385 TTATTACATTGTAATATATAAGG + Intergenic
1156740115 18:40315584-40315606 AGCCTACATTGTAAGCTCCAAGG - Intergenic
1159449972 18:68588469-68588491 ATATTATCTTATAAGATCTAAGG + Intergenic
1160059311 18:75515056-75515078 CTCACACATTGTAAGATATATGG - Intergenic
1162254006 19:9472724-9472746 TTATTACATTGTAATATATAAGG - Intronic
1162632292 19:11938246-11938268 ATATTATATTTTAAGTTCTAGGG + Intronic
1168307576 19:55443670-55443692 ATCTTACATTGTCACAACTCGGG - Intergenic
925422185 2:3721618-3721640 ATCTTATCTTGTAACTTCTACGG + Intronic
926848921 2:17173366-17173388 ATATTAAATTGTAAAATCTGTGG - Intergenic
930143715 2:47979826-47979848 TTATTACATTTTAAGTTCTAGGG - Intergenic
932225634 2:70038116-70038138 GTTTTACATTGAAGGATCTATGG - Intergenic
932994608 2:76835393-76835415 ATCTTAAATTCTAAAATCAATGG + Intronic
933217249 2:79644454-79644476 ATCTTACATTACATGATCAAGGG - Intronic
935000290 2:99007271-99007293 TTCTTATACTTTAAGATCTAGGG - Intronic
935565168 2:104598606-104598628 TTATTACATTGTAATATATAGGG + Intergenic
938529434 2:132169343-132169365 ATCTTACATATTAAGATGAATGG + Intronic
938552884 2:132396941-132396963 TTATTACATTGTAATATATAAGG + Intergenic
940672071 2:156682816-156682838 CTGTCACTTTGTAAGATCTATGG - Intergenic
941107587 2:161375625-161375647 ATTTTACATTCTAATATCTGTGG - Intronic
941255895 2:163230627-163230649 ATTTCACATTGTAGGATCTCGGG + Intergenic
941621934 2:167788343-167788365 TTATTACATTGTAATATATAAGG + Intergenic
946530112 2:220561556-220561578 ATATTACACTTTAAGTTCTAGGG - Intergenic
947536211 2:230941861-230941883 ATCTTACATTGTAAGATCTAAGG + Intronic
1169595481 20:7193655-7193677 ATGTTACATTGCAAGTTTTATGG - Intergenic
1169621503 20:7512184-7512206 ATTTTACACTGTAAGCTCTGTGG - Intergenic
1170391147 20:15876126-15876148 TTATTACACTGTAAGTTCTAGGG + Intronic
1176767078 21:13030576-13030598 ATCTTACATATTAAGATGAATGG - Intergenic
1176961457 21:15163718-15163740 ATGTTACAATGTAAAATATAGGG - Intergenic
1177171221 21:17658272-17658294 ATCTTACATTGAAGTATTTATGG + Intergenic
1180431641 22:15256941-15256963 ATCTTACATATTAAGATGAATGG - Intergenic
1180514202 22:16124847-16124869 ATCTTACATATTAAGATGAATGG - Intergenic
949486326 3:4543044-4543066 ATTATACATTTTAAGAGCTATGG - Intronic
949999307 3:9644345-9644367 TTATTACACTCTAAGATCTAGGG - Intergenic
952463966 3:33560801-33560823 ATATTACCTTGTAACATCAAGGG + Exonic
955737946 3:62059436-62059458 ATCTTACCTTGTAAGAAATATGG + Intronic
955986292 3:64576988-64577010 TTGTTACATTGTGAGATCGAAGG - Intronic
957042278 3:75345136-75345158 ATTTTGCATTGTAATAACTAAGG - Intergenic
957321839 3:78641306-78641328 ATCTTAGAGTGTAAAGTCTAGGG - Intronic
957423629 3:80005942-80005964 ATCAAACATTTAAAGATCTAAGG - Intergenic
958101976 3:89023710-89023732 ATCTTGCAAAGTAAGGTCTATGG - Intergenic
960291887 3:115895840-115895862 ATTTTACATTCTAACTTCTAGGG + Intronic
960560437 3:119077397-119077419 TTCTTTCATTTTAAGTTCTAGGG - Intronic
961047007 3:123715986-123716008 ATTTTGCATTGTAATAACTAAGG - Intronic
962494976 3:135930175-135930197 ATTTTACCTTCTAGGATCTATGG + Intergenic
963171914 3:142260105-142260127 ATCTAACTATGTAATATCTATGG + Intergenic
963198052 3:142555302-142555324 ACCTTACATTACAAGATTTAGGG + Intronic
963682680 3:148399805-148399827 ATCTTAGATTTTTAGATCTCAGG - Intergenic
963811843 3:149785272-149785294 TTATTACATTTTAAGTTCTAGGG + Intronic
964270588 3:154951280-154951302 ATATTACACTATAAGTTCTAGGG - Intergenic
970782693 4:19758071-19758093 ATTTTACATTGTATCATGTAGGG - Intergenic
971090562 4:23339027-23339049 AACTTACATTGCAAACTCTAGGG + Intergenic
972201928 4:36723293-36723315 ATCAGACATTGTAAAATCAAAGG + Intergenic
972522539 4:39873500-39873522 CTCTTACTTTGTATGATTTAAGG - Intronic
976971963 4:91114892-91114914 TTCTTACATTTTAAAATCTGTGG - Intronic
978079331 4:104573131-104573153 ATCCTACACAGTAAGAACTACGG - Intergenic
979095648 4:116546706-116546728 ATATTACATTGTAATATATAGGG + Intergenic
979138525 4:117143024-117143046 ATCTTATAGTGTAAAATATATGG + Intergenic
979153640 4:117354239-117354261 TTCTTTCATTGTAAGACCTTTGG - Intergenic
979301386 4:119091601-119091623 ATCTGAAAGTGTTAGATCTAAGG - Intergenic
979752202 4:124292375-124292397 ATCTTACATTTTTTGATCTTAGG + Intergenic
980327777 4:131370736-131370758 TACTGACATTGAAAGATCTATGG - Intergenic
983325591 4:166251959-166251981 ATCTTACATTTTAAAAGCTTTGG + Intergenic
984882633 4:184424003-184424025 AGCATACATTGTAAGACATAAGG - Intronic
990569378 5:57062534-57062556 ATCTTACATTATTTGATCTAAGG - Intergenic
992013807 5:72556694-72556716 ACCTTCAGTTGTAAGATCTAAGG + Intergenic
993135846 5:83962943-83962965 ATCTTAGATAGTCAGATCTTAGG + Intronic
993818886 5:92589316-92589338 ATATAACCTTGTAAGATCAAAGG + Intergenic
995424598 5:112006087-112006109 CTCTTCCATTGTAAAATCTTAGG - Intergenic
996472820 5:123879666-123879688 ATGTTACATTGAAAGGTCTTGGG + Intergenic
997413025 5:133704557-133704579 TTCTTACCTTGTAAGAACAATGG - Intergenic
998601402 5:143588949-143588971 AACTTTCATTTTAAGTTCTAGGG - Intergenic
998787565 5:145729220-145729242 ATCATTCATTGTAAGATTCAGGG - Intronic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1000962800 5:167620174-167620196 ATGTACCATTGTCAGATCTAAGG - Intronic
1001386109 5:171340453-171340475 ATTTTACTTTGTAACATATAGGG + Intergenic
1004656448 6:17666621-17666643 GACTTACATTGTAAGATTTTTGG - Intronic
1004669994 6:17786630-17786652 ATTTTACAGAGTAAGATATATGG - Intronic
1005351695 6:24942093-24942115 ATCTTTCATTATAAGATTTAGGG - Intronic
1008895296 6:56546965-56546987 ATCCTACATTATAAAATCTCTGG + Intronic
1011111836 6:83846847-83846869 ATCCTTCATTGTCATATCTAAGG + Intergenic
1011472825 6:87724856-87724878 ATCTTACGTACCAAGATCTATGG - Intergenic
1014460597 6:121690371-121690393 AACTTACATTGTTATATTTAAGG + Intergenic
1015614927 6:135064664-135064686 ATCTTACAGTGTGACAACTAAGG - Intronic
1015756824 6:136615842-136615864 ATTTGTCAGTGTAAGATCTAAGG - Intronic
1016197710 6:141366295-141366317 AACTTACATTTTAAGTTCTGGGG + Intergenic
1016381220 6:143483252-143483274 CAATTAGATTGTAAGATCTATGG - Intronic
1017353027 6:153466848-153466870 ATCTTAAAATTTAAGATCAATGG - Intergenic
1017735554 6:157359750-157359772 TTATTACATTGTAATATATAAGG + Intergenic
1021072205 7:16254717-16254739 TTCTTATACTTTAAGATCTAGGG - Intronic
1022380672 7:29856719-29856741 ATTTTACCTTGTCAGATCAATGG + Intronic
1022609256 7:31852730-31852752 ATCTTACATTGTATTTTCTTTGG + Intronic
1022963704 7:35454208-35454230 TTCTTACTTTGACAGATCTATGG - Intergenic
1028107167 7:86892343-86892365 CTCCTATATTGTAATATCTAGGG - Intronic
1028383317 7:90223751-90223773 ATGATACATTGTAAGATGTAGGG + Intronic
1028940274 7:96513865-96513887 ATATTACATAGCAATATCTATGG - Intronic
1030463132 7:109865908-109865930 ATCTAAAAGTGTCAGATCTATGG + Intergenic
1031502834 7:122542485-122542507 AACTTTCATTTTAAGATCAAGGG + Intronic
1032556277 7:132838776-132838798 ATCTACCCTTGTAAGATCAAAGG + Intronic
1038051284 8:23815235-23815257 ATCTTATAATGTAATAACTATGG - Intergenic
1041646540 8:60258597-60258619 TTATTACATTGTAATATATAAGG + Intronic
1041712623 8:60908041-60908063 TTGTTACATTGTAATATATAAGG - Intergenic
1042181322 8:66090547-66090569 ATCTCACATTTTTAGATCCAAGG - Intronic
1043076801 8:75711464-75711486 ATTTTGCATTGTAATTTCTAGGG - Intergenic
1043082161 8:75780421-75780443 ATCTTACATAATAACATCCATGG - Intergenic
1043210700 8:77512287-77512309 ATTTTTCATTGTAAGAATTAGGG - Intergenic
1043471424 8:80566573-80566595 ATCTGACATTGTAAAATGCAGGG + Intergenic
1044141995 8:88667687-88667709 ATGTTAAATTTTAATATCTAGGG + Intergenic
1046679052 8:117147222-117147244 ATCTTACTTTATAAGAACTTAGG - Intronic
1048590385 8:135815680-135815702 ATCTTTCATTGTCACATCTGAGG + Intergenic
1048647389 8:136437626-136437648 ATCTTACATATTAAGATGAATGG + Intergenic
1050818598 9:9848186-9848208 AAATTACAATGTAAAATCTATGG - Intronic
1051960255 9:22751983-22752005 ATCTTAAATTATAAAATCAAAGG - Intergenic
1053658573 9:40246627-40246649 TTCTTATACTGTAAGTTCTAGGG + Intronic
1053708038 9:40775604-40775626 ATCTTACATATTAAGATGAATGG + Intergenic
1054370692 9:64392901-64392923 TTCTTATACTGTAAGTTCTAGGG + Intronic
1054417949 9:64896394-64896416 ATCTTACATATTAAGATGAATGG + Intergenic
1054526025 9:66129595-66129617 TTCTTATACTGTAAGTTCTAGGG - Intronic
1054678324 9:67882649-67882671 TTCTTATACTGTAAGTTCTAGGG + Intronic
1055780772 9:79819293-79819315 ATCTTACATTTTAATATTGAGGG + Intergenic
1056147183 9:83744008-83744030 ATCTTACATTGGCAGAGCTGTGG - Intronic
1056497621 9:87175689-87175711 ATCTTAAATAAAAAGATCTATGG - Intergenic
1060245611 9:121943499-121943521 ATCTTCCATTGTAAAATAAAAGG - Intronic
1186571917 X:10724023-10724045 ATCTTACTCTGTAAGATATTAGG + Intronic
1187659342 X:21522513-21522535 ATTTTACATTTTAACATCTCTGG - Intronic
1188714575 X:33446107-33446129 ATCTTAGGATGTAAGATATAGGG - Intergenic
1191624981 X:63261088-63261110 TTATTACATTTTAAGATTTAGGG + Intergenic
1193696428 X:84712134-84712156 TTCTTACATTTTCAGATCTTTGG + Intergenic
1193754559 X:85391894-85391916 ATCTTAAATTTACAGATCTAAGG - Intergenic
1193869224 X:86776599-86776621 TTATTACATTTTAAGTTCTATGG + Intronic
1195532476 X:105972177-105972199 ATCTTTTATTTTAAGATCTGGGG - Intergenic
1198955602 X:142125832-142125854 ATATTATACTGTAAGTTCTAGGG - Intergenic
1200870833 Y:8096459-8096481 ATATTATATTTTAAGTTCTAGGG + Intergenic
1201187429 Y:11417635-11417657 ATCCTGCATTTTAAAATCTAAGG - Intergenic
1201737379 Y:17283003-17283025 ATCTTACATTCAAAGCTCTGGGG + Intergenic