ID: 947538197

View in Genome Browser
Species Human (GRCh38)
Location 2:230954221-230954243
Sequence CTGTGTCAGGGGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 831}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947538197 Original CRISPR CTGTGTCAGGGGAAGGGGCA AGG (reversed) Intronic
900230608 1:1555144-1555166 CTGTGTGTGTGGCAGGGGCATGG - Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900415474 1:2532632-2532654 CTGGCTCAGGGGAAGGGACCAGG - Intergenic
900422116 1:2560164-2560186 TGGAGGCAGGGGAAGGGGCAAGG + Intronic
900500524 1:3002322-3002344 CGGTGTCAGAGGAAGGAGCTGGG - Intergenic
900541652 1:3205956-3205978 CTGAGTCAGGGCAGGGGGCTGGG - Intronic
900659527 1:3775693-3775715 CTGGGTCAGGGGGAGGGGCCTGG - Intronic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
900986994 1:6078883-6078905 CTTTGCCTGGGGAAGGTGCAGGG + Intronic
901161039 1:7177032-7177054 CCTTGTGAGGGGAGGGGGCATGG - Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
902078407 1:13804953-13804975 CTGTGTCAGGGAGTGGGGCATGG + Intronic
902147924 1:14419400-14419422 CTGTGACAAGGGAATGGGCTGGG - Intergenic
902332271 1:15736442-15736464 CTGTGCCCGGGTCAGGGGCACGG - Exonic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903273796 1:22208328-22208350 CAGTGGCTGGGGCAGGGGCAGGG + Intergenic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903894547 1:26595385-26595407 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894550 1:26595391-26595413 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894553 1:26595397-26595419 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894556 1:26595403-26595425 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894559 1:26595409-26595431 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
903894562 1:26595415-26595437 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904490534 1:30856204-30856226 CTGTCTCAGGGGAAGGGTTGAGG - Intergenic
904620417 1:31771905-31771927 CTTTGTGAGGGTAAGGGGTAAGG - Intergenic
904985798 1:34547434-34547456 CTTGGGTAGGGGAAGGGGCAGGG + Intergenic
905281957 1:36855032-36855054 CTGTGTCAGGGGCAAGAACAAGG + Intronic
905295693 1:36953182-36953204 CAGGGGCAGGGGGAGGGGCAAGG - Intronic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
906346823 1:45020793-45020815 AGGTGTCAAGAGAAGGGGCAGGG + Intronic
906459603 1:46027317-46027339 CTGTTTCAGGGAGAGGGGCAGGG - Intronic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908111713 1:60904606-60904628 CTGTGTCATGGGGCTGGGCAAGG + Intronic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
910230614 1:84983053-84983075 CAGTCTCAGGGGATGGGGCAGGG + Intronic
911155040 1:94628526-94628548 CTGGGGTAGGGGCAGGGGCAGGG + Intergenic
912316297 1:108670211-108670233 CTGTGCCAGGGGATGAGGAAAGG - Intergenic
912701501 1:111881648-111881670 CTGGGGCAGGGCAAAGGGCAGGG + Intronic
913045802 1:115072677-115072699 CCGTGTGAGGGCAAGGGGAAGGG + Intronic
913314866 1:117541062-117541084 CTCTGCCTGGGGTAGGGGCAAGG + Intergenic
913586234 1:120278059-120278081 CCGAGGCAGGGGCAGGGGCAGGG + Intergenic
913621952 1:120620310-120620332 CCGAGGCAGGGGCAGGGGCAGGG - Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
913937236 1:125065929-125065951 CTGTGTCTGGGGCTGGGGCTGGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914568243 1:148889917-148889939 CCGAGGCAGGGGCAGGGGCAGGG + Intronic
914604582 1:149240332-149240354 CCGAGGCAGGGGCAGGGGCAGGG - Intergenic
915312523 1:155011630-155011652 CTGTGCCAGGGAACCGGGCAAGG - Intronic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915549927 1:156625836-156625858 CTAAGACAGGGTAAGGGGCAGGG + Intergenic
915567146 1:156721515-156721537 GTGTGTCAGGGGGAGTTGCATGG + Intergenic
915743996 1:158142152-158142174 CTATGGCAGGGGCGGGGGCAGGG + Intergenic
916091338 1:161309908-161309930 CTGGGGCAGGGGCAGGGGCCCGG + Exonic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
916926021 1:169521477-169521499 CTCTGTCAGGAAAAGGGGTAGGG - Intronic
917245218 1:172993629-172993651 CTTTGACAGGGGCAGGGTCATGG - Intergenic
917284646 1:173411256-173411278 TAGTGTCAGGGGCAGGGGCAGGG + Intergenic
917789178 1:178488442-178488464 CAGGGTCTGGGGAAGTGGCAAGG - Intergenic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
921238576 1:213153300-213153322 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
921238579 1:213153306-213153328 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
921238582 1:213153312-213153334 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
922395958 1:225201751-225201773 CTGCTTCAGTGGAAGTGGCAAGG + Intronic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
923025386 1:230199778-230199800 CTGTGTCAAAGGAGGCGGCAGGG + Intronic
923057688 1:230439699-230439721 CTGTGTCAGGGCAGGAGGCAGGG - Intergenic
923255051 1:232214655-232214677 TTGTGTCAGGGGATGGGACGGGG + Intergenic
924220695 1:241872501-241872523 CTGTGGCAGGGTAGGGGGCTAGG - Intronic
924321363 1:242854538-242854560 CTGTTTCAGTGGAGGTGGCAGGG + Intergenic
1063022547 10:2144249-2144271 GTGTGTCTGGGGTGGGGGCAGGG - Intergenic
1063224757 10:4005207-4005229 CAGTGTCCGGAGAAAGGGCATGG + Intergenic
1063556209 10:7081921-7081943 CTGTTTAAGGGGTAGGGACACGG - Intergenic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065471479 10:26086342-26086364 ACGTGTCAGGGGAGGGGGCCTGG - Intronic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1066431614 10:35357178-35357200 CTGGGGCTGGGGCAGGGGCAGGG - Intronic
1066758984 10:38737168-38737190 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1066962645 10:42235601-42235623 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1069242620 10:66162334-66162356 CTCTGTCAGGGGGAGGGTCTAGG + Intronic
1069904844 10:71726217-71726239 CTGGTTTAGGGGAAGGGGCTGGG - Intronic
1069981341 10:72255049-72255071 CTGGGTCCTGGGAAGGGGCTTGG + Intergenic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070239594 10:74665399-74665421 CTGGGTCAGAGGCAGTGGCAGGG + Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070845017 10:79514540-79514562 CTATTTCTGGGGAATGGGCAGGG - Exonic
1070928787 10:80245769-80245791 CTATTTCTGGGGAATGGGCAGGG + Intergenic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072016139 10:91348643-91348665 GTGGGTCAGGAGCAGGGGCATGG + Intergenic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073091139 10:100940791-100940813 CAGGGGCAGGGGGAGGGGCAGGG - Intronic
1073112737 10:101072230-101072252 CTGTGTCCTGGGAGGAGGCAAGG + Intergenic
1073271128 10:102265029-102265051 CTGTGGCATGGGATGGGGCATGG + Intronic
1073361952 10:102906726-102906748 TTGTGTCAGGTGAAGTGGCCTGG + Intergenic
1073445857 10:103579987-103580009 AAGAGTCAGTGGAAGGGGCAAGG - Intronic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074829856 10:117240935-117240957 CTGGGTCCGGGGAAGAGGCGCGG + Intergenic
1075588948 10:123677664-123677686 CTGTGTCATGGGAAAGGCCCAGG + Intronic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075724585 10:124604881-124604903 CAGGGGCAGGGGAAGGGGCAGGG - Intronic
1075815204 10:125259754-125259776 CAGGGGCAGGGGTAGGGGCAGGG + Intergenic
1075936932 10:126350925-126350947 CCTGGACAGGGGAAGGGGCAGGG - Intronic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1076568081 10:131412370-131412392 CTGGGACAGAGGCAGGGGCAGGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076740035 10:132478446-132478468 CTGCTGCAGGGGAAGGGGCCAGG - Intergenic
1077235850 11:1481715-1481737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077235853 11:1481721-1481743 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1077239151 11:1501637-1501659 CTGTGCCAAGGGAAGGGACTGGG + Intergenic
1077874677 11:6294111-6294133 CAGGGGCAGGGGAAGGGGCAGGG + Intergenic
1077996544 11:7457332-7457354 CTATGTCAGGGGCAGGCACAGGG - Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078992505 11:16664326-16664348 CTGTGCCAGGGGATGGGGTAGGG - Intronic
1079101676 11:17545675-17545697 CCCTGTCAAGGGCAGGGGCAAGG + Intergenic
1079572813 11:21965657-21965679 CTGGGTTGGAGGAAGGGGCAGGG - Intergenic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1081532207 11:43969740-43969762 CTCTGTCAGGCTAAGTGGCAGGG - Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081810511 11:45911435-45911457 TTGGTTCAGGGGAAGGGGCAAGG + Intronic
1081917044 11:46738976-46738998 CTGTGTCTCGTGAAGGGGCGTGG + Intronic
1082200508 11:49360664-49360686 ATGTGGGAGGGAAAGGGGCAGGG + Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082777397 11:57257544-57257566 CTTTTACAGTGGAAGGGGCAAGG - Intergenic
1082940895 11:58703999-58704021 AAGTCTCAGGGGAAGGGGAAGGG - Intronic
1084057232 11:66643379-66643401 CAGTGTCTGGGGTAGGGGCTGGG + Intronic
1084155790 11:67311777-67311799 CAGGGGCAGGGGCAGGGGCAGGG + Exonic
1084296627 11:68216404-68216426 CCGAGTCAGCGGAAGGGGCCCGG + Intergenic
1084458983 11:69285793-69285815 CTGTGTCAGGGTTGGGGCCAGGG + Intergenic
1084680496 11:70663676-70663698 CTGTCTCTGGGGAGGGGGCAAGG - Intronic
1084856328 11:71990002-71990024 CTTTGCCTGGGGAAGGGGCCAGG + Intronic
1084937998 11:72597468-72597490 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1085034940 11:73293965-73293987 CTGTGTGAGGAGAGGGGTCAGGG + Intronic
1085566989 11:77523074-77523096 CTGAGAGAGGGAAAGGGGCAAGG + Intronic
1086178416 11:83920042-83920064 CTGTGTCAGGGTCTGTGGCATGG - Intronic
1086365843 11:86109743-86109765 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365846 11:86109749-86109771 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365849 11:86109755-86109777 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1086365852 11:86109761-86109783 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1086983477 11:93223836-93223858 CAGTGTCAGGGGCTGGGTCATGG + Intergenic
1087116696 11:94533091-94533113 CTTTGTAAGGGGTAGGGGCTGGG - Intergenic
1088546406 11:110963844-110963866 CTTCATCAGGTGAAGGGGCAGGG - Intergenic
1089100548 11:115958883-115958905 CGGGGCCAGGGGAAGGGCCAAGG - Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089536272 11:119162324-119162346 CAGTGGCTGGGGAAGGGGTAGGG - Exonic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089753756 11:120670651-120670673 AAGTGTCAGGGGCAGAGGCAGGG - Intronic
1089875290 11:121715454-121715476 ATGTGGCAGGGGTGGGGGCACGG + Intergenic
1089966079 11:122655957-122655979 CTGGGCCAGGGGAGGGGGCTCGG - Exonic
1090464748 11:126924180-126924202 CTGAGCCAGGGAAAGGGGGAAGG - Intronic
1090762533 11:129849805-129849827 CAGTTTCAGGGGAAGGGCCCAGG - Intronic
1090793528 11:130113638-130113660 AGGTGACAGCGGAAGGGGCAGGG - Intronic
1091331899 11:134737031-134737053 CTGTGCCAGGTGGAGGGGCCTGG - Intergenic
1091532652 12:1374450-1374472 CTGCATCAGAGGAAGGGGCCAGG + Intronic
1091710146 12:2734115-2734137 CAGACTCAGGGGAAGGGGAAGGG + Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091755925 12:3051493-3051515 CTCTGTCAAGGGAAGGGGAGAGG - Intergenic
1091787977 12:3254425-3254447 CTGACCCAGGGGAAGGGGCAAGG - Intronic
1091791219 12:3273323-3273345 CTTCGGCTGGGGAAGGGGCAGGG + Intronic
1092252764 12:6910050-6910072 CCTGGTCAGGGGTAGGGGCAAGG - Intronic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092540246 12:9416169-9416191 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1094419665 12:30257415-30257437 CACTGTCAGGGGATGGGGGAGGG - Intergenic
1094491815 12:30965458-30965480 CTGGGTCAGAGGAAGGCGCTCGG - Intronic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095872747 12:47048584-47048606 ATATGTCAAGGGCAGGGGCAAGG - Intergenic
1095943009 12:47738615-47738637 CTGTGGCCTGGGAAGGGGCAGGG - Intronic
1095952658 12:47790177-47790199 CCCGGTCAGGGGAGGGGGCATGG + Intronic
1096073791 12:48789568-48789590 CTGGGGCTGGGGCAGGGGCAGGG - Intergenic
1096464059 12:51838507-51838529 CTGAGTCATGGGAGGGGGAAGGG - Intergenic
1096499709 12:52057281-52057303 GTGTATCAGGGAAAGGGGCTGGG - Intronic
1097017625 12:55998535-55998557 CCCTGTCAGGGGCAGGGGGAGGG + Intronic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1097261963 12:57725442-57725464 CAGTTTGTGGGGAAGGGGCAGGG + Intronic
1098253765 12:68595513-68595535 CTGTGTTTTGGGGAGGGGCAGGG - Intergenic
1098397676 12:70039162-70039184 CTGTTTCAGGCAAAGGAGCAGGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100603428 12:96131768-96131790 CTGTATCAGAGGCAGGGTCAAGG + Intergenic
1100852377 12:98726594-98726616 GTGTGTCAGCTGAAGTGGCAGGG + Intronic
1100909307 12:99339388-99339410 CATTGTCAGGGAATGGGGCAGGG + Intronic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1103175725 12:118861650-118861672 CTGAGACGGGGGAAGGGGAAAGG - Intergenic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104444592 12:128823323-128823345 CTGGGGCAGGGGAAGAGGCTGGG + Intronic
1104539408 12:129648509-129648531 CTCTATCAGGGCAATGGGCAAGG + Intronic
1104714204 12:131005753-131005775 CTGGCTCAGGGGATGGAGCAGGG + Intronic
1104908663 12:132229061-132229083 CTGTGCCAGTGCATGGGGCAGGG + Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105016482 12:132788882-132788904 CTGTGTCTGGGGTGGGGCCAAGG - Intronic
1106466409 13:30018024-30018046 CTGGGCCAGGGGTAGGGCCATGG + Intergenic
1107629985 13:42333607-42333629 CTGTGTCAGGAGACGGGGCGGGG - Intergenic
1108742367 13:53351189-53351211 CTATGTAAGTGGAGGGGGCAGGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111885425 13:94014699-94014721 GGTTGTCAGGGGATGGGGCAAGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112420884 13:99247579-99247601 CTGTCTATGGGTAAGGGGCAAGG + Intronic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113914298 13:113861696-113861718 TTGGGGCAGGGGCAGGGGCAGGG - Intronic
1114174585 14:20309261-20309283 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1115176658 14:30569670-30569692 CTTGGTCAGTGGAAGGGGCTAGG + Intronic
1115720415 14:36154731-36154753 CTCTCTCTGGGGGAGGGGCAAGG + Intergenic
1117533946 14:56686614-56686636 CAGAGTCAGGGGAAAGGGCACGG - Intronic
1117763837 14:59059696-59059718 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1117763840 14:59059702-59059724 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1118158662 14:63266972-63266994 CTGTGTCAGGGGTAGTGTGAGGG - Intronic
1118316564 14:64729557-64729579 CTGTGTCAGGGCAAAAGGCATGG + Intronic
1118502404 14:66374097-66374119 CTGAGACTGGGCAAGGGGCAAGG - Intergenic
1118638417 14:67769316-67769338 CTCTGTCTGGGGAAGGGCTAAGG + Intronic
1119322712 14:73741102-73741124 CTTCGGCAGTGGAAGGGGCAGGG - Intronic
1120742087 14:88119398-88119420 CTGTGGCAAGGGTAGGAGCATGG - Intergenic
1120818070 14:88883883-88883905 CTGTTTTAAGGGAAGGGGCCGGG - Intergenic
1121693207 14:95892540-95892562 CTATGTTTGGGGAAGTGGCATGG + Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122396678 14:101437721-101437743 GTGTGTAAGGGGACAGGGCAGGG - Intergenic
1122457412 14:101865103-101865125 CTGGTTCAGGGGAAAGAGCATGG + Intronic
1122631621 14:103109856-103109878 CTGTGCTGGGGGAGGGGGCAGGG - Intronic
1122853464 14:104548744-104548766 CTGGGGCAGGGGTGGGGGCAGGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123053711 14:105559750-105559772 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053714 14:105559756-105559778 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123053717 14:105559762-105559784 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078296 14:105680173-105680195 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078299 14:105680179-105680201 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078302 14:105680185-105680207 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1123078314 14:105680209-105680231 CAGGGGCAGGGGCAGGGGCACGG - Intergenic
1202929718 14_KI270725v1_random:26772-26794 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123422583 15:20144472-20144494 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123442431 15:20301892-20301914 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123443691 15:20306801-20306823 CTGGGCCAGGGGCAGGGCCAGGG - Intergenic
1123531811 15:21151012-21151034 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123584140 15:21742223-21742245 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1123620790 15:22184826-22184848 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1123712843 15:23002491-23002513 CTGAATCAGGGGAAGTGGCCCGG - Intronic
1123976618 15:25559850-25559872 GTGATTCAGGGGAAGGAGCACGG - Intergenic
1124461865 15:29899498-29899520 TGGTGGCAGGGAAAGGGGCAGGG + Intronic
1124651824 15:31479682-31479704 CTGTCTCTGGGGAGGGGTCATGG - Exonic
1124687291 15:31793136-31793158 CTGCTTCCGGGGAAGGTGCATGG - Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125685486 15:41560939-41560961 CTGGGCGAAGGGAAGGGGCATGG - Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128358344 15:66943685-66943707 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1128674016 15:69595674-69595696 CTGTGGGAGGGCATGGGGCAGGG + Intergenic
1129113197 15:73350268-73350290 CGGTGCCAGGAGGAGGGGCATGG - Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1129918431 15:79295609-79295631 CTGTGTCAGGGGACGGGTCTGGG - Exonic
1130095306 15:80851153-80851175 ATGTGGGAGGGGGAGGGGCAGGG + Intronic
1130522241 15:84672239-84672261 CAGAGGCAGGGGCAGGGGCATGG - Intronic
1130985634 15:88842803-88842825 TTGTGTCAGGGGTAAGGGTAAGG - Intronic
1131112993 15:89776907-89776929 CAGGGGCAGGGGCAGGGGCAAGG + Exonic
1131296482 15:91153808-91153830 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1131352973 15:91718355-91718377 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1131401434 15:92128498-92128520 ATGGGGCAGGGGATGGGGCAGGG + Intronic
1131622362 15:94081431-94081453 CAGTGTCAGGGAAAGGCACATGG + Intergenic
1131812135 15:96183681-96183703 CGGGGTCGGGGGCAGGGGCAGGG - Intergenic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132354176 15:101159202-101159224 TTGAGACAGGGGAAGGGGCTGGG - Intergenic
1132552397 16:558984-559006 CTGTGTCAGGGAAGGTGGCATGG + Intergenic
1132663558 16:1071927-1071949 CAGAGTCAGGGGAGGGGGCTGGG + Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132802850 16:1762764-1762786 CAGCTGCAGGGGAAGGGGCAGGG + Intronic
1132875396 16:2134939-2134961 AGGTGTGAGGGGTAGGGGCAGGG - Intronic
1132906989 16:2287778-2287800 CTGAGTCAGGGGAAGTGCCCTGG - Intronic
1133335556 16:5004573-5004595 CTGGGACAGGGGTGGGGGCAGGG + Intronic
1134203257 16:12216325-12216347 ATGTGTCAAGGAAAGGGTCAGGG - Intronic
1134219644 16:12343715-12343737 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1134519588 16:14912421-14912443 AGGTGTGAGGGGTAGGGGCAGGG + Intronic
1134554343 16:15153814-15153836 AGGTGTGAGGGGTAGGGGCAGGG - Intergenic
1134707260 16:16311077-16311099 AGGTGTGAGGGGTAGGGGCAGGG + Intergenic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1134960281 16:18401048-18401070 AGGTGTGAGGGGTAGGGGCAGGG - Intergenic
1135776081 16:25258184-25258206 CTGTGTCTGGCGGAGGGACACGG + Intergenic
1136688419 16:32009817-32009839 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1136789014 16:32953356-32953378 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1136862169 16:33710888-33710910 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1136880798 16:33900578-33900600 CTCTGTCAGGGTCAGGGTCATGG + Intergenic
1137432170 16:48427230-48427252 CAGTCCCAGGGGCAGGGGCAGGG + Intronic
1137468823 16:48736172-48736194 CTGTGGCAGAGGAAAAGGCATGG + Intergenic
1137833019 16:51562379-51562401 GGGGGTCAGAGGAAGGGGCAGGG - Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1140636261 16:76918159-76918181 TTGAGTCATGGAAAGGGGCATGG + Intergenic
1141050221 16:80754857-80754879 CTGTATCAGGGAAGGGAGCAGGG + Intronic
1141701931 16:85646608-85646630 CTGTGTCAGGGAAGGGGGCTTGG + Intronic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142279200 16:89138946-89138968 GCGAGTCTGGGGAAGGGGCACGG - Intronic
1142284698 16:89167005-89167027 CTGTGGCTGGGGATGGGGCTGGG - Intergenic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1203091216 16_KI270728v1_random:1214847-1214869 CTCTGTCAGGGTCAGGGTCATGG - Intergenic
1203123663 16_KI270728v1_random:1559071-1559093 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142592399 17:1012099-1012121 CTGGGGCGGGGGCAGGGGCAGGG + Intronic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1142894395 17:2964502-2964524 CTGGGATAGGGGACGGGGCAGGG + Intronic
1143136799 17:4716655-4716677 CTGTGTCTGGGGTGGGGGTAAGG + Exonic
1143143141 17:4754469-4754491 GTGTGTGTGGGGTAGGGGCAGGG - Intergenic
1143176651 17:4959485-4959507 CTGGGGCAGGGCAGGGGGCAGGG - Exonic
1143444353 17:6998640-6998662 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1143582989 17:7837032-7837054 TTTTGTGAGGGGGAGGGGCACGG + Intergenic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143986457 17:10918870-10918892 CTGTGTCTCAGGAAGCGGCAAGG - Intergenic
1144027883 17:11294421-11294443 CTTTGGCAGGATAAGGGGCAGGG + Intronic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1145005686 17:19336467-19336489 CTGTGCCAGAAGATGGGGCAGGG - Exonic
1146407781 17:32554187-32554209 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146407784 17:32554193-32554215 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1146559686 17:33857414-33857436 CTGTGACAGAGGAAAAGGCAGGG - Intronic
1146681742 17:34813304-34813326 CTGGGCCTGGGGAAGTGGCAGGG + Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147149407 17:38505536-38505558 CTCTGTCAGGGTCAGGGTCATGG - Intronic
1147166492 17:38596239-38596261 CTAGGTCAGGGGCAGGGCCATGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147310523 17:39593420-39593442 CTGTGTCCAGGGAAGGGGCAGGG + Intergenic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1147654099 17:42078723-42078745 CTGGGGCAGAGGCAGGGGCATGG + Intergenic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148614671 17:48991221-48991243 CAGGGGCAGGGGGAGGGGCAGGG + Intergenic
1148688043 17:49511793-49511815 CCGTGTGAGGGCCAGGGGCATGG - Intronic
1148898713 17:50858231-50858253 CTGGGTCAGGGGGAGGGGGATGG - Intergenic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1151499446 17:74479754-74479776 CACAGTCAGGGGATGGGGCACGG - Intronic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151747394 17:76018777-76018799 CTGAGTCAAGGGAAGGAGTAGGG + Intronic
1151875889 17:76868236-76868258 TTGGCTCAGGGGAAGGAGCAGGG + Intergenic
1151950352 17:77350109-77350131 CTGTTTCAGGGCCAGGGGCCTGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152266118 17:79295878-79295900 CTGTGGCAGGGCATGGGGAAGGG + Intronic
1152572002 17:81125022-81125044 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1152637616 17:81436563-81436585 GAGTGGCAGGGCAAGGGGCAGGG - Intronic
1153052042 18:908693-908715 CTGTTTCTGGGGGAGGGGAAAGG + Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153680084 18:7492249-7492271 CTGTTTGAGGGTAAGGGGTAGGG + Intergenic
1154017983 18:10637407-10637429 ATGTGTGAGTGGGAGGGGCAGGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154186887 18:12192175-12192197 ATGTGTGAGTGGGAGGGGCAGGG - Intergenic
1154227193 18:12516169-12516191 CTTTATCAGAGGAAGGAGCAGGG - Intronic
1154415528 18:14173637-14173659 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1156527127 18:37777943-37777965 CAGGGTCAGGGGACAGGGCAGGG + Intergenic
1157238482 18:45986603-45986625 CTTTCTCATGGAAAGGGGCAAGG - Intronic
1157449092 18:47772201-47772223 GGGTGTCAGGGGAGGAGGCAAGG + Intergenic
1157551055 18:48582198-48582220 CAGTGTCAGAGGAAGGGTCCTGG + Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160569375 18:79806295-79806317 CTGTGTCGGGGGTCGGGGCATGG + Intergenic
1160812103 19:1017369-1017391 CTGGGTCAGGGACAGGGTCATGG - Intronic
1160814041 19:1027159-1027181 CTTTGGGAGGGGAAGGGGCATGG + Intronic
1160816004 19:1036107-1036129 CTGGGTGAGGGAAAGGGGCCGGG - Intronic
1160906068 19:1452239-1452261 CAGAGTCAAGGGATGGGGCAGGG + Exonic
1161170156 19:2808462-2808484 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161170159 19:2808468-2808490 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1161409730 19:4110476-4110498 CCGGGGCAGGGGCAGGGGCAGGG - Intronic
1161409734 19:4110482-4110504 GTGCGTCCGGGGCAGGGGCAGGG - Intronic
1161761012 19:6172862-6172884 AGGTCTCAGGGGTAGGGGCAGGG + Intronic
1161772584 19:6239125-6239147 CTGTGTCCAGAGGAGGGGCAGGG - Intronic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1161991995 19:7689446-7689468 TTGGGTCAGGGGATGGGGCGGGG + Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162307585 19:9884710-9884732 CTTTGTGGAGGGAAGGGGCAGGG - Intronic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1162552272 19:11364470-11364492 CGCTGGCAGGGGTAGGGGCAGGG - Exonic
1163018722 19:14471792-14471814 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1163018725 19:14471798-14471820 CTCGGGCAGGGGCAGGGGCAGGG - Exonic
1163368712 19:16890080-16890102 CAGTGTCAGGGGCAGTGCCAGGG - Exonic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1164871424 19:31647506-31647528 CTGCTTCTGGGGAAGGTGCAGGG + Intergenic
1164917787 19:32065858-32065880 CTGGGGCAGGGGGAGGGCCAGGG + Intergenic
1165101970 19:33444426-33444448 CTGTGTCCCGGTAAGGGGCCAGG + Intronic
1165244532 19:34490611-34490633 CTCTGTCTGGGGAGGAGGCATGG + Intronic
1165722685 19:38090816-38090838 CTTGGTCAGGGGATGGGGCGAGG - Intronic
1165792907 19:38502750-38502772 GTGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792910 19:38502756-38502778 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792913 19:38502762-38502784 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792916 19:38502768-38502790 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792919 19:38502774-38502796 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792922 19:38502780-38502802 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165792925 19:38502786-38502808 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1165814486 19:38633244-38633266 CTCAGTCAGGGGAAAGGACAAGG - Intronic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166250841 19:41569950-41569972 CTGGGCCAGGGGGAGGAGCAGGG - Intronic
1166314969 19:41984734-41984756 CTGGGTCCGGAGAAGGGGCTGGG - Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167052723 19:47089601-47089623 CTTTGTCAGGTGATGGGGCTGGG + Intronic
1167096896 19:47379497-47379519 CTGAGTCAGGGAAGGGGGCTGGG - Intronic
1167121534 19:47520258-47520280 CCCTGGCAGGGGCAGGGGCAGGG - Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167263996 19:48474357-48474379 CTGTGGCAGGAAGAGGGGCAGGG - Intronic
1167289346 19:48615835-48615857 CTGAGTCTGGGGAGAGGGCAGGG + Intronic
1167327087 19:48833262-48833284 CAGGGTCAGGGGGTGGGGCAGGG + Intronic
1167597442 19:50435093-50435115 CTGCGTCTGAGGGAGGGGCATGG + Intronic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
1168022515 19:53619962-53619984 CTGTGACAGGGGATGAGGCAGGG - Intergenic
925022992 2:586850-586872 TTGGGGCAGGGGCAGGGGCAGGG - Intergenic
925069519 2:955955-955977 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069542 2:956033-956055 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
925069551 2:956051-956073 CAGGGTCAGGGGTAGGGGCAGGG - Intronic
925161137 2:1685230-1685252 CTGTCCCGGGGCAAGGGGCAGGG - Intronic
925319463 2:2951138-2951160 CTGTGCTGGAGGAAGGGGCACGG + Intergenic
925924266 2:8659188-8659210 CTGCCCCAGGGGCAGGGGCAGGG + Intergenic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926305805 2:11636765-11636787 CAGGGGCAGGGGCAGGGGCACGG + Intronic
926488502 2:13493686-13493708 CTGAGTCAGAGGAAGAGCCATGG - Intergenic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927292631 2:21419911-21419933 CTGCGGCAGGGGAAGGGACAAGG + Intergenic
927705348 2:25293283-25293305 CTGGGAGAGGGGAGGGGGCAGGG - Intronic
927938568 2:27089291-27089313 CAGGGACTGGGGAAGGGGCACGG + Intronic
928023209 2:27720214-27720236 GTGTGTGCAGGGAAGGGGCAAGG + Intergenic
928315015 2:30238158-30238180 CTCTGTCTGGGGAAGGGTCTTGG + Intronic
928350740 2:30551419-30551441 CTGAGTCTAGGGATGGGGCAAGG - Intronic
928394060 2:30930799-30930821 CTAGGTCAGTGGAAGGGGCCAGG - Intronic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929508423 2:42547094-42547116 CTGTCTCTGGGGGAGGGGCCAGG - Intronic
929579411 2:43072114-43072136 CTGAGTCTCAGGAAGGGGCACGG + Intergenic
930373913 2:50540057-50540079 CTTTGTCAGGGAGAAGGGCATGG + Intronic
930486455 2:52017521-52017543 CTGTTTCAGTGGAGGTGGCAGGG + Intergenic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932056659 2:68452377-68452399 CTTTGTTTGGGGGAGGGGCAGGG - Intergenic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932406159 2:71513653-71513675 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932544064 2:72688528-72688550 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
932544067 2:72688534-72688556 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
932594382 2:73085173-73085195 CTGTGGCAGCGGAAGGAGCTTGG - Intronic
933610494 2:84429494-84429516 CTGTGCCAGGGGACTGGGCAGGG + Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934187762 2:89762291-89762313 GGGTGTCAGGGGCTGGGGCAGGG - Intergenic
934308855 2:91845657-91845679 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
934460617 2:94212330-94212352 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
934558621 2:95300716-95300738 CTGTGGCAGGGAAAGAAGCAAGG + Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935402350 2:102673884-102673906 CTGAGGCAGGAGAATGGGCATGG - Intronic
936350963 2:111712224-111712246 CTGTATCTGGGCAGGGGGCAAGG + Intergenic
937060395 2:118976522-118976544 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
937338672 2:121077184-121077206 CTGTGGCCGCGGAAGGGGCCGGG + Intergenic
937512387 2:122611035-122611057 TTCTGCCAGGGGATGGGGCAGGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937762900 2:125627386-125627408 CTGTTGCAGGGGAGGGGGCAAGG + Intergenic
937913328 2:127086892-127086914 TGGTGTCAGGGGACGGAGCATGG - Intronic
937914448 2:127092125-127092147 CTGGGGCAGGGGCAGGGACAGGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
940029610 2:149247693-149247715 CTTTGGCTGGGGAAAGGGCAGGG - Intergenic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941252588 2:163184825-163184847 CTGTGTCAGGGAAACTGGGAGGG - Intergenic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
942651971 2:178178479-178178501 ATGTCACAGGGGCAGGGGCAGGG + Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
943145734 2:184042768-184042790 CTGTGTCAAGGGGAGGACCAGGG + Intergenic
943795445 2:191987177-191987199 GATTGTCTGGGGAAGGGGCAGGG - Intronic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
944977250 2:205068160-205068182 CTCTGTTTGGGGATGGGGCAGGG + Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946127503 2:217576584-217576606 CTGATTCCGGGGATGGGGCAGGG + Intronic
946192533 2:218015166-218015188 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
946322272 2:218960949-218960971 GTGTGTCAGGGGCTGGGGCGGGG - Exonic
946413216 2:219526041-219526063 CTGTGGCAGGGGGAGGGCCCTGG - Intronic
946580822 2:221126859-221126881 TTGTGTCAGGGAAAGGGACCTGG + Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948458270 2:238117264-238117286 CTGTGACAGGGGTGGGGCCAGGG + Intronic
948575536 2:238947185-238947207 CTGTGCCTGGGGCAGGGGCGGGG + Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948660101 2:239501728-239501750 TTGTAACAGGGGGAGGGGCAAGG + Intergenic
948665716 2:239533603-239533625 CGGTGTCTGGGCAAGAGGCAGGG - Intergenic
948790175 2:240372772-240372794 CTGTGGTGGGGGGAGGGGCATGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948815388 2:240507725-240507747 CTCTGTCAGGGGAAGTGACATGG - Intronic
1168871669 20:1134752-1134774 ACGTGTCATGGGAAGGGTCATGG - Intronic
1169227317 20:3864817-3864839 CTGTCCCGGGGGAAGGGGCCAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1171198481 20:23222492-23222514 CTGTTTCAGTGGAGGTGGCAAGG + Intergenic
1171232495 20:23498855-23498877 CTGTGTCTGGGGTAGAGGGACGG - Intergenic
1171347882 20:24479521-24479543 CATTATCAGAGGAAGGGGCATGG - Intronic
1171400709 20:24871681-24871703 CTGTGCCTGGGGCAGGAGCAGGG - Intergenic
1171448257 20:25219572-25219594 CTGCTTCAGGGGCTGGGGCACGG + Intronic
1171483103 20:25468565-25468587 CAGTGACAGGGGACAGGGCAGGG - Intronic
1172379431 20:34475691-34475713 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1172379434 20:34475697-34475719 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172379437 20:34475703-34475725 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1172881044 20:38200174-38200196 CTGCCTCAGTGGAAGAGGCAGGG - Intergenic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1173942892 20:46927021-46927043 CTGTGTCATGGGCAAGGACATGG + Intronic
1174136059 20:48380659-48380681 GTGTGCCTGGGGAAGAGGCAGGG + Intergenic
1174605714 20:51759949-51759971 GTGTGTCTGGGGGCGGGGCAGGG - Intronic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175632383 20:60552596-60552618 TTGAGTCAGAGGAAGGGGCTGGG + Intergenic
1175819547 20:61901228-61901250 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175819550 20:61901234-61901256 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1175908179 20:62392028-62392050 GTGGGCCAGGGGAAGGGCCACGG + Intronic
1176017429 20:62942497-62942519 TTATGTCAGGGGCAGGGGAAGGG + Intronic
1176379212 21:6103397-6103419 CAGCGGCAGGGGCAGGGGCAGGG + Intergenic
1176379215 21:6103403-6103425 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176591740 21:8655371-8655393 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176857792 21:13985631-13985653 CTGGGTCAGGGCCAGGAGCAAGG - Intergenic
1176866798 21:14058558-14058580 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1177173516 21:17679696-17679718 ATGTGTAAGGGGAAGCGTCAGGG - Intergenic
1177429284 21:20969603-20969625 CTGTTTCATGGGAAGGGCCGTGG + Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1179604973 21:42509295-42509317 CAGCATCAGGGGAAGTGGCAAGG - Intronic
1179710397 21:43209939-43209961 TGGTGTCAGGGCAATGGGCATGG + Intergenic
1179744258 21:43434834-43434856 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1179744261 21:43434840-43434862 CAGCGGCAGGGGCAGGGGCAGGG - Intergenic
1179890254 21:44331576-44331598 CTGTGCCAGGGCACGGGGCCTGG + Intronic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180002552 21:45001936-45001958 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1180042332 21:45287199-45287221 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1180274587 22:10632483-10632505 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180535938 22:16392745-16392767 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
1180549070 22:16527427-16527449 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180619137 22:17148405-17148427 CTGGCTGAAGGGAAGGGGCAGGG - Intronic
1181031422 22:20150302-20150324 CTGGGGCTGGGGCAGGGGCAGGG + Intronic
1181031442 22:20150345-20150367 CTGGGGCTGGGGCAGGGGCAGGG + Intronic
1181031445 22:20150351-20150373 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181112927 22:20612413-20612435 ATGGGTCAGGGGAACTGGCAAGG - Intergenic
1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG + Intergenic
1181355630 22:22294425-22294447 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1181439257 22:22927384-22927406 CTGGGGCCGGGGAAGGAGCAAGG - Intergenic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182447376 22:30397498-30397520 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
1182757777 22:32694284-32694306 ATGTGGCAGGGGAAGGGATATGG - Intronic
1182831279 22:33306524-33306546 CTGTGGCAGGTCACGGGGCAGGG - Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183347801 22:37317557-37317579 CTGTGTCAGGGCACGGGGCGGGG + Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183465352 22:37977684-37977706 CGGTGCCAGGGGAAGTGGCTGGG - Intronic
1183752702 22:39731068-39731090 CTGTGCTAGGGGAGGGGGCTGGG + Intergenic
1184114997 22:42417152-42417174 CTGTGTGAGGGTGAGGGGCGAGG - Intronic
1184254703 22:43280443-43280465 ATGGGTGAGGGGAAGGGACAGGG - Intronic
1184457337 22:44618597-44618619 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1184537966 22:45100290-45100312 CTGTGCCAGAGGAGGAGGCATGG + Intergenic
1185051305 22:48555716-48555738 CTGTCTCAGGGGATCGGACAAGG - Intronic
1185143543 22:49117170-49117192 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143546 22:49117176-49117198 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143549 22:49117182-49117204 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1185143557 22:49117200-49117222 CAGGGCCAGGGGTAGGGGCAGGG + Intergenic
1185227540 22:49661417-49661439 CTGTGTGAGTGGCAGGGCCAAGG - Intergenic
1185419985 22:50729815-50729837 CTGTGTCAGGGGAAGCCTCAAGG - Intergenic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
949859473 3:8492303-8492325 CTGGGTCAGAGGGAGGGGCTCGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950271314 3:11617487-11617509 CTGAGTCAGGGAACAGGGCAGGG + Intronic
950442932 3:13020243-13020265 CGGGGTCTGGGGCAGGGGCAGGG + Intronic
950442935 3:13020249-13020271 CTGGGGCAGGGGCAGGGGCAGGG + Intronic
950530278 3:13549059-13549081 CGGAGTCAGGGGAGGGGGCCGGG + Intergenic
950670559 3:14522900-14522922 CTTCATCTGGGGAAGGGGCATGG + Intronic
951727194 3:25773745-25773767 CTATGTCAGAGGAAGGATCAGGG + Intronic
952416531 3:33095754-33095776 CAGTGGCAGGGTAAGGGGCTAGG - Intronic
952502455 3:33976743-33976765 CCCTGTGAGGAGAAGGGGCATGG + Intergenic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953791616 3:45951862-45951884 CTCTGCCAGGAGGAGGGGCAAGG + Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955698380 3:61659043-61659065 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
956683419 3:71802815-71802837 GGGAGTCAGGGGAAGGGGAAAGG + Intergenic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957129098 3:76200230-76200252 TTGGGTCTGGGGAAGGAGCAAGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
960348511 3:116564958-116564980 CTGGGTCAGGGGGAGTGGCAAGG - Intronic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960543149 3:118882656-118882678 CTGTCACTGGGGAAGGGCCATGG + Intergenic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
961427743 3:126861495-126861517 CGGTGGCAGTGGCAGGGGCAGGG - Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961484321 3:127206722-127206744 CAGGGACAGGGGTAGGGGCAGGG + Intergenic
961484343 3:127206776-127206798 CAGGGCCAGGGGCAGGGGCAGGG + Intergenic
961532384 3:127547515-127547537 CTGGGTCCGGGGGAGGGGTAGGG + Intergenic
961906668 3:130269883-130269905 CTGGGGCAGGGGCAGGGGCAGGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
963974091 3:151461097-151461119 CTGTGTCTGGGGACGCGGCCGGG + Intergenic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
965276952 3:166696058-166696080 CTGTGTCAGGGTTAGGGATAGGG + Intergenic
967178848 3:186885575-186885597 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
967178851 3:186885581-186885603 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967178854 3:186885587-186885609 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
967297544 3:187979853-187979875 CTGTGTCAGCCTCAGGGGCAAGG - Intergenic
967303972 3:188042960-188042982 CTGTGTCAGAGGATGGGAAAAGG - Intergenic
968085772 3:195873269-195873291 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
968236201 3:197031129-197031151 CTGGATCAGGGGAAGGAACATGG + Intergenic
968283841 3:197496695-197496717 CTGTGTCAGGGAAGGTGCCATGG + Intergenic
968287080 3:197515027-197515049 CTGTGCCTTGGGAAGGAGCACGG - Intronic
968298640 3:197596522-197596544 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968517397 4:1020893-1020915 CCCAGGCAGGGGAAGGGGCAGGG + Intronic
968562986 4:1294808-1294830 CGGGGGCAGGGGCAGGGGCAGGG + Intronic
968606449 4:1537900-1537922 CTGGGGCAGGGGAAAGGCCAGGG + Intergenic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969282405 4:6179537-6179559 TTGTGTCAGGGCAATGGGCTTGG - Intronic
969351982 4:6603379-6603401 CTGTGTCCTGGGATGGGGCCTGG - Intronic
969422530 4:7105596-7105618 CAGAGTCAGGGGAAGGCTCATGG - Intergenic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969484733 4:7465956-7465978 CTGGGGCAGGGGCAGGGCCAGGG + Intronic
972287559 4:37663279-37663301 CTGTCTCCTGGGAAGGGGCTGGG + Intronic
974969364 4:68805204-68805226 TTGTTTCAGGGGAGGGGGAAGGG - Intergenic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975732367 4:77350144-77350166 CTGTAGCAGGGGGAGTGGCATGG + Intronic
975885341 4:78958416-78958438 ATTTGTCAGGGGTAGGGGGATGG - Intergenic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
978713834 4:111817674-111817696 CTGTGTCAGGAGTCTGGGCATGG - Intergenic
979328500 4:119404570-119404592 CTGGGGCAGAGGCAGGGGCAAGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
981457568 4:144971756-144971778 GTGTGGCAGTGGAAGTGGCAAGG - Intronic
981782588 4:148444550-148444572 CTGGGGCGGGGGAAGGGGAACGG + Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
983441392 4:167790995-167791017 CTGTGTCAGGGGGCCGGGCGCGG - Intergenic
984284333 4:177709898-177709920 TTGTGTCTGGGGTAGGAGCATGG - Intergenic
984478234 4:180264903-180264925 GGGAGTGAGGGGAAGGGGCATGG - Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
985471470 5:49730-49752 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985726261 5:1517329-1517351 CTGTGTCAGAGGCAGGGACATGG + Intronic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790976 5:1926635-1926657 CTGGGGCAGGCGCAGGGGCAGGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
987911363 5:24150563-24150585 GTGTGTGGGGGGATGGGGCATGG + Intronic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
989328741 5:40230174-40230196 GTGGGTCAGGGGTAGGGACATGG - Intergenic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
991292743 5:65048541-65048563 CTGAGTCAGTGGTGGGGGCATGG - Intergenic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
992442359 5:76808183-76808205 CTGGGCCAGGGGTGGGGGCAGGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
995694513 5:114864991-114865013 CTCTGTCAGAGGAAGGGTCTAGG + Intergenic
995901719 5:117077099-117077121 TTGGGTCAAGGGAAGAGGCAAGG + Intergenic
996364519 5:122686537-122686559 CGGGGTCAGGGGAGGGGGGAGGG + Intergenic
996616400 5:125446420-125446442 CTGTGCCAAGGGTAGGAGCAGGG + Intergenic
997702158 5:135910204-135910226 CTGGGTCAGGGTCAGGGTCAGGG + Intergenic
998179432 5:139926096-139926118 CTGTGTCAGAGGAAGGCCCTAGG - Intronic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998626288 5:143850067-143850089 CTAGGTCAGGTGCAGGGGCATGG + Intergenic
999204460 5:149837967-149837989 GTGGGGCAGGGGCAGGGGCAGGG + Intronic
999204463 5:149837973-149837995 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
999288189 5:150406802-150406824 CAGTGCCAAGGGGAGGGGCAGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999677182 5:154015634-154015656 CTGTGTCAGAGGAAAGGTCTAGG - Intronic
1000123070 5:158216438-158216460 CTGTTACAGGGAGAGGGGCAAGG - Intergenic
1000530285 5:162410753-162410775 CTGTGTCAGGGAAAGCTTCATGG - Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001219616 5:169889073-169889095 CTGTGTCAAGCGGAGGGGTAAGG - Intronic
1001247896 5:170118786-170118808 CTGTCACAGGTGAGGGGGCAAGG + Intergenic
1001317319 5:170653042-170653064 CTGGGTCGGGGGAAGGAGCGAGG + Intronic
1001324079 5:170707361-170707383 ATGTGTCAGGACAAGGAGCAAGG - Intronic
1002000682 5:176194860-176194882 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002106222 5:176880603-176880625 CTGGGGGAGGGGCAGGGGCAGGG - Exonic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003116118 6:3284819-3284841 TGGTGCCAGGGGAAGGGGCGGGG + Intronic
1003335556 6:5168645-5168667 ATGGGGCAGGGGCAGGGGCAGGG + Intronic
1004169244 6:13283278-13283300 GTGAGTGAGGGGCAGGGGCAGGG - Intronic
1004285143 6:14314803-14314825 CGGTGGCAGGGGATGGGCCAGGG - Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005215370 6:23521285-23521307 CTGAGAGAGGTGAAGGGGCAGGG - Intergenic
1005859076 6:29887798-29887820 CTGGGTCAGGGTCAGGGCCAGGG - Intergenic
1006075302 6:31528878-31528900 GTGGGGCAGGGGCAGGGGCAGGG + Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006839447 6:37019119-37019141 CTGGGTCAGGGAGAGGGGAAAGG - Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1007077725 6:39078533-39078555 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077728 6:39078539-39078561 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1007077731 6:39078545-39078567 CTGGGACAGGGGCAGGGGCAGGG - Intronic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1007231067 6:40348020-40348042 GTGTGCTGGGGGAAGGGGCAGGG + Intergenic
1007312406 6:40957009-40957031 GTGGGGCAGGGGGAGGGGCAGGG - Intergenic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1008377780 6:50810769-50810791 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377783 6:50810775-50810797 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1008377786 6:50810781-50810803 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1009798564 6:68503199-68503221 CTGTTTTAGTGGAAGTGGCAGGG - Intergenic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1011462741 6:87622663-87622685 CTGTATCCAGGGAAGGGACATGG - Intronic
1011535853 6:88375284-88375306 CTCTGGCAGGGGAAGGGTCCTGG + Intergenic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1011805052 6:91062208-91062230 AAGTCTCAGAGGAAGGGGCAGGG + Intergenic
1011999897 6:93641092-93641114 CTGTCTCAGGGGTGGGGCCAAGG + Intergenic
1012232365 6:96775097-96775119 CTCTGTTAAGGGAAGGGTCAAGG + Intergenic
1012232752 6:96779607-96779629 CTCTGTTAAGGGAAGGGTCAAGG + Intergenic
1012260859 6:97085876-97085898 CTATGTCAGGCGAAAAGGCAGGG - Intronic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1013204372 6:107933674-107933696 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013204375 6:107933680-107933702 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1013210554 6:107983128-107983150 CTGAGTCATGGGGAGGGACACGG + Intergenic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013293069 6:108735427-108735449 GTGTGGCAGGGTAAGGGTCATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013799979 6:113931578-113931600 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1013799982 6:113931584-113931606 CAGAGGCAGGGGCAGGGGCAGGG - Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1015175039 6:130296930-130296952 AAGTGTCAGGGGAAGGGGCTGGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015778574 6:136839948-136839970 ATTTGTCTGGGGAAGGGGCAGGG + Intronic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016929646 6:149391546-149391568 CAGGGACAGGGGCAGGGGCAGGG + Intronic
1017096757 6:150811720-150811742 CTGAGGCAGGGGCTGGGGCAGGG + Intronic
1017717811 6:157224467-157224489 CTGTGTCAAGGGAATGTGCTGGG - Intergenic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018037436 6:159893376-159893398 GTGTCTCAGGGTAGGGGGCAGGG + Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018534238 6:164802801-164802823 TTGTGATGGGGGAAGGGGCAGGG + Intergenic
1019110019 6:169702221-169702243 CAGGGGCAGGGGCAGGGGCAGGG - Exonic
1019175867 6:170159287-170159309 CAGTGGCAGGTGAAGGGGCTGGG - Intergenic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019563172 7:1667779-1667801 CTGGGTCTGGGGGAGGGGCAGGG + Intergenic
1019641464 7:2105970-2105992 GTGGGGCAGGGGCAGGGGCAGGG - Intronic
1019709505 7:2511810-2511832 CTGCGGCAGGGGCAGGGGCTGGG - Intergenic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1021440033 7:20667673-20667695 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440036 7:20667679-20667701 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440039 7:20667685-20667707 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440042 7:20667691-20667713 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440045 7:20667697-20667719 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440048 7:20667703-20667725 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440051 7:20667709-20667731 CAGGGGCAGGGGCAGGGGCAGGG - Intronic
1021440054 7:20667715-20667737 CAGAGGCAGGGGCAGGGGCAGGG - Intronic
1021542570 7:21776096-21776118 ATGAGTCAGGGGGATGGGCAAGG + Intronic
1021848814 7:24788186-24788208 CTGGGGCAGGGGAAGAGCCAGGG - Intergenic
1022023193 7:26421300-26421322 TCGTGTCTGGGGAAGGGGCCGGG - Intergenic
1022185815 7:27967294-27967316 ATGTCTCAGGGGTAGGGGTATGG - Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023200349 7:37690419-37690441 CTGTGAAAGGGGAAAGGACAGGG - Intronic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1024220317 7:47281918-47281940 CAGGGTCAGGGTCAGGGGCATGG - Intronic
1024315917 7:48016407-48016429 CTCTGTCAAGGCAATGGGCAAGG + Intronic
1025752796 7:64307739-64307761 GTGGGACAGAGGAAGGGGCAGGG - Intronic
1026317348 7:69238691-69238713 CTTTGGCAGGGGACTGGGCATGG - Intergenic
1026433376 7:70370322-70370344 CTGGGGCAGTGGAATGGGCAAGG - Intronic
1026593644 7:71716342-71716364 TGGTGTGAGGGGAAGGGGCTGGG - Intergenic
1027972415 7:85102348-85102370 CTGTGTCAGGGCAAAGACCATGG + Intronic
1029110359 7:98210826-98210848 CTGTGTCAGGGGGAGGGTCGGGG + Intergenic
1029382036 7:100220848-100220870 AGGTGACAGGGGCAGGGGCAGGG + Intronic
1029569532 7:101360460-101360482 CAGAGGCAGGGGCAGGGGCAGGG + Intergenic
1029569535 7:101360466-101360488 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569538 7:101360472-101360494 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569541 7:101360478-101360500 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029569544 7:101360484-101360506 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1029611155 7:101627327-101627349 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1029611158 7:101627333-101627355 CAGGGGCAGGGGCAGGGGCAGGG + Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030505622 7:110418259-110418281 ATGTGTCAAGGGAAGAAGCAAGG - Intergenic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1031179058 7:118392051-118392073 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179061 7:118392057-118392079 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179064 7:118392063-118392085 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179067 7:118392069-118392091 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179070 7:118392075-118392097 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1031179072 7:118392081-118392103 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032268757 7:130385550-130385572 ATGTGACAGAGCAAGGGGCAGGG + Intronic
1032478355 7:132227326-132227348 GAGAGTCAGAGGAAGGGGCATGG - Intronic
1033282823 7:140017850-140017872 CAGAGGCAGGGGCAGGGGCAGGG + Intronic
1033655385 7:143370131-143370153 CTGTGTTGGGGGCAGGGCCAAGG + Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034411589 7:150945171-150945193 CAGTGAGAGGGGCAGGGGCAGGG - Exonic
1034422714 7:150997816-150997838 ATGTGTCAGTGACAGGGGCAGGG - Intronic
1035307605 7:157943324-157943346 CTGGGGCATGGGAGGGGGCATGG - Intronic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1035960004 8:4126313-4126335 CTCTGTCTGGGCAGGGGGCAAGG + Intronic
1036653775 8:10662583-10662605 CCGAGTCAGGGGAAGCGGGAGGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1036915175 8:12797573-12797595 CTTGGTCTGGGGAAGAGGCAGGG + Intergenic
1037644998 8:20785097-20785119 ATCTGCCAGGGGAAGGGACAGGG + Intergenic
1037690973 8:21181344-21181366 CTGTGTCAGGAGAGAGGGCAAGG - Intergenic
1037710124 8:21348680-21348702 CAATGGCAGGGGCAGGGGCAGGG + Intergenic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1038438911 8:27558262-27558284 CTGTCCCTGAGGAAGGGGCAGGG - Intergenic
1038740561 8:30213135-30213157 CTGTCTCAGAGGGAGGAGCAGGG + Intergenic
1039769800 8:40673865-40673887 CCCTGTCTGGGGCAGGGGCATGG + Intronic
1040415233 8:47189208-47189230 ATGTGGCAGTGGAAGGCGCAGGG + Intergenic
1040510118 8:48085757-48085779 ATGCATCAGGGGCAGGGGCAAGG - Intergenic
1040635580 8:49269925-49269947 CTGTGTCAGGGGGAAGGTCTAGG + Intergenic
1040697460 8:50019047-50019069 CTGGGTCTGGGGAAGGGTCAAGG + Intronic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1042267632 8:66925339-66925361 CTGCGCCCGGGGAAGGGACAGGG + Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1045002015 8:97886770-97886792 CTTTGTCAGAGGCAGGGACAGGG - Intronic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045516226 8:102863420-102863442 CTGTTTCCGGGGAGGGGGCCCGG - Intronic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048575557 8:135687157-135687179 CTCACTCAGGGGCAGGGGCAGGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049194584 8:141308338-141308360 CTGCGTCAGCGGAAGCGGCGCGG - Intergenic
1049271365 8:141697984-141698006 CAGCATCAGGGGAAGAGGCAAGG - Intergenic
1049359069 8:142203285-142203307 CTGGGACAGGGGTAGGGGCAGGG + Intergenic
1049359622 8:142206110-142206132 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1049424353 8:142531481-142531503 CAGGGCCAGGGGAAGGGCCAAGG + Intronic
1049483462 8:142839165-142839187 GGGTCTCAGGGGAATGGGCATGG + Intronic
1049684481 8:143933876-143933898 CTGGGGCAGGGGCAGGGGCAGGG - Intronic
1049998924 9:1055559-1055581 TGGTATCAGGGGAAGGGGCCTGG + Intronic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1051519000 9:17962960-17962982 CTGTGTCAGGGCTTGGGGCCAGG + Intergenic
1051765961 9:20524018-20524040 AGGGGTCAGGGGAAGTGGCAGGG + Intronic
1052247103 9:26349092-26349114 TAGTTTCAGGGGAAGGGGAAGGG - Intergenic
1052829309 9:33202175-33202197 CAGTTTCAGTAGAAGGGGCAGGG + Intergenic
1053691114 9:40588027-40588049 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054273690 9:63049464-63049486 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1054302374 9:63388998-63389020 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054434755 9:65199818-65199840 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054495634 9:65821863-65821885 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1056803837 9:89712910-89712932 CAGGGTGAGGGGCAGGGGCAGGG + Intergenic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1058850995 9:109012715-109012737 CAGGTTCAGGGGAAGGGGTAGGG + Intronic
1059165521 9:112073099-112073121 CGGTGTCAGAGGCAGGGGCAGGG + Intronic
1059269564 9:113063291-113063313 CTGGGGCCGGGGTAGGGGCAGGG + Intergenic
1059270696 9:113068738-113068760 CTGGGGCCGGGGTAGGGGCAGGG + Intergenic
1059271831 9:113074185-113074207 CTGGGGCCGGGGTAGGGGCAGGG + Intergenic
1059272965 9:113079632-113079654 CTGGGGCCGGGGTAGGGGCAGGG + Intergenic
1059274100 9:113085074-113085096 CTGGGGCCGGGGTAGGGGCAGGG + Intergenic
1059451360 9:114373072-114373094 CTGTGGCAGGGGCAGGGTCCTGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1060802106 9:126551400-126551422 CAGGGGCAGGGGAAGGGTCAGGG - Intergenic
1060802111 9:126551412-126551434 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1060802114 9:126551418-126551440 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1061389591 9:130310088-130310110 CTGGGAAAGGGGAATGGGCAGGG - Intronic
1061678300 9:132230521-132230543 CTGCCCCAGGGGAAGGGGCCTGG - Intronic
1062197666 9:135283134-135283156 CTGCTCCTGGGGAAGGGGCAGGG + Intergenic
1062236512 9:135512509-135512531 CTGTGTCAGGGTCTGGGGAAGGG + Intergenic
1062244932 9:135561427-135561449 CTGTGTCCAGGGCAGGGGTATGG - Intergenic
1062444833 9:136589238-136589260 CAGTGTGAGCGGAAGAGGCAGGG + Intergenic
1062675460 9:137740526-137740548 CTGTGTCCAGGGAAGGGGTCTGG - Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062731329 9:138111762-138111784 CTGTGTCACCCGAAGGGCCAGGG - Intronic
1203768195 EBV:37259-37281 CAGGGGCAGGGGCAGGGGCAGGG + Intergenic
1203768197 EBV:37265-37287 CAGGGGCAGGGGCAGGGGCAAGG + Intergenic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1203621767 Un_KI270749v1:134135-134157 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1186059955 X:5694194-5694216 CTGCTTTAGGGGATGGGGCAGGG - Intergenic
1186658357 X:11640988-11641010 CTGTGTAAGTGACAGGGGCATGG + Intronic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187411339 X:19053148-19053170 CTGTGTCAGGAACAGGGGCAAGG - Intronic
1188003830 X:25004442-25004464 CAGTAGCAGGGGCAGGGGCAGGG + Exonic
1188537946 X:31218362-31218384 ATGGGGCAGGGGCAGGGGCAGGG + Intronic
1188668251 X:32851689-32851711 CTCTGCCAGGGGATGGGGGAGGG - Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1190152025 X:47956985-47957007 CACTGGCAGGGGAAGGGGCTTGG + Intronic
1190265695 X:48826378-48826400 CAGTGGCAGGGGCAGGGGCGCGG + Intergenic
1190300531 X:49054471-49054493 CAGAGTCAGGGGCAGGGACAAGG - Intronic
1190904157 X:54709633-54709655 CTGCTTCAGGGAAGGGGGCAAGG - Intergenic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1191085491 X:56563552-56563574 CTGGGGGAGGGGAAGGGGCGGGG + Intergenic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1192317944 X:70066700-70066722 CTCTGACAGCGGAAGGGGCTGGG + Intergenic
1193850875 X:86536070-86536092 TAGTTTCAGGGGAAGGGGAAGGG + Intronic
1193934814 X:87604835-87604857 CTGTGACATTGGGAGGGGCAAGG - Intronic
1195017514 X:100793894-100793916 CTGTTTCAGGGGATTGTGCAGGG - Intergenic
1195641513 X:107180714-107180736 CTGAGTATGGGAAAGGGGCAGGG + Intronic
1196675693 X:118418569-118418591 CTGTACCAGTGGAAGTGGCAGGG + Intronic
1196940018 X:120766341-120766363 CTGGGTCAGGGGTTGGGGCAGGG + Intergenic
1197774786 X:130111631-130111653 ATGAGTCAGGGGAAGGGCTAGGG + Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1199332869 X:146582375-146582397 CAGGGGCAGGGGCAGGGGCAGGG - Intergenic
1199332872 X:146582381-146582403 CTTGGTCAGGGGCAGGGGCAGGG - Intergenic
1200112102 X:153745621-153745643 GGGTGTCAGGGGCTGGGGCAGGG + Intergenic
1200364005 X:155641839-155641861 CAGTTTCAGGGGAGGGGGAAGGG + Intronic
1200392571 X:155958578-155958600 CAGTTTCAGGGGAGGGGGAAGGG + Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1202583824 Y:26405245-26405267 CAGGGTCAGGACAAGGGGCAGGG + Intergenic