ID: 947538537

View in Genome Browser
Species Human (GRCh38)
Location 2:230957546-230957568
Sequence GCCCAGCACCGCCGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947538537_947538551 24 Left 947538537 2:230957546-230957568 CCGCGGCGCCGGCGGTGCTGGGC 0: 1
1: 0
2: 2
3: 24
4: 231
Right 947538551 2:230957593-230957615 GTGGCCGCCGCTCCGGAGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 162
947538537_947538544 -10 Left 947538537 2:230957546-230957568 CCGCGGCGCCGGCGGTGCTGGGC 0: 1
1: 0
2: 2
3: 24
4: 231
Right 947538544 2:230957559-230957581 GGTGCTGGGCGGGTGGAGGCGGG 0: 1
1: 0
2: 9
3: 82
4: 994
947538537_947538546 5 Left 947538537 2:230957546-230957568 CCGCGGCGCCGGCGGTGCTGGGC 0: 1
1: 0
2: 2
3: 24
4: 231
Right 947538546 2:230957574-230957596 GAGGCGGGGAGTCGTCCCCGTGG 0: 1
1: 0
2: 1
3: 7
4: 82
947538537_947538547 17 Left 947538537 2:230957546-230957568 CCGCGGCGCCGGCGGTGCTGGGC 0: 1
1: 0
2: 2
3: 24
4: 231
Right 947538547 2:230957586-230957608 CGTCCCCGTGGCCGCCGCTCCGG 0: 1
1: 0
2: 1
3: 9
4: 124
947538537_947538545 -9 Left 947538537 2:230957546-230957568 CCGCGGCGCCGGCGGTGCTGGGC 0: 1
1: 0
2: 2
3: 24
4: 231
Right 947538545 2:230957560-230957582 GTGCTGGGCGGGTGGAGGCGGGG 0: 1
1: 0
2: 6
3: 49
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947538537 Original CRISPR GCCCAGCACCGCCGGCGCCG CGG (reversed) Intronic
900242974 1:1625649-1625671 GCCCAGCCCCCCCGGCACCTTGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900483699 1:2911390-2911412 TCCCTGCACCGCGGCCGCCGCGG + Intergenic
900933881 1:5753422-5753444 ACCCAGCACCCCCGGCTCAGAGG + Intergenic
901279962 1:8026294-8026316 GCACCGGACCGCCGTCGCCGCGG + Exonic
902375133 1:16026921-16026943 GCCCCGCCCCGCCGCCCCCGGGG - Intronic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902448938 1:16484676-16484698 GCTCAGCACCCCCGGCCCTGGGG - Intergenic
903652495 1:24930308-24930330 GCCCCGCCCCGCGGGCCCCGGGG - Intronic
903750253 1:25616951-25616973 TCCCGGCCCCGCCGGCTCCGCGG - Intergenic
903822105 1:26111129-26111151 CCCCTGCCCCGCCGGCGCGGTGG - Intergenic
903867830 1:26411522-26411544 GTCCATGACCGCCCGCGCCGGGG + Exonic
904265538 1:29316678-29316700 GCCCAGCACTGCTGGCGGCCAGG - Intronic
904724879 1:32539662-32539684 TCCCAGCACTGCCGCCGCCCGGG - Intronic
906365420 1:45205969-45205991 CGCCAGCAGCGCCGGCGCCGGGG + Exonic
906534519 1:46544177-46544199 GCCCATCGCTGCCGCCGCCGGGG - Intergenic
906960885 1:50419004-50419026 GCCCAGCGCCCCAGGCGCCATGG + Exonic
907051202 1:51330687-51330709 GCCCAGAACCCCCGGCGGTGCGG - Intronic
907611879 1:55879472-55879494 GCCGAGCAGCGCTGGAGCCGGGG - Intergenic
908355635 1:63323198-63323220 GCGCAGCTCCGGCGGCCCCGCGG - Exonic
911052362 1:93681676-93681698 GCCTCGCACCGCCCGCGCCGCGG + Intronic
913703292 1:121395926-121395948 GCCCTCCACCGCCGCCGCCACGG + Intergenic
914702930 1:150150339-150150361 CCCCCGCTCCGTCGGCGCCGCGG + Intronic
915165674 1:153946574-153946596 TCCCAGCTCCCGCGGCGCCGGGG + Exonic
915238307 1:154501940-154501962 GCCCAGGAGCGTCGGGGCCGTGG + Exonic
915333527 1:155127886-155127908 GCCCAGCGCTGACTGCGCCGCGG + Exonic
915608148 1:156968021-156968043 GCCCAGCACCACAGGCGGCAGGG - Exonic
916785670 1:168085455-168085477 TCCCATCACCGCCTGTGCCGCGG - Exonic
917291739 1:173477733-173477755 GCCCAGCCACGCCGGAGGCGGGG - Intronic
918064220 1:181088869-181088891 GCACAGGGCCGTCGGCGCCGGGG - Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920340385 1:205271904-205271926 GCCCAGCAGCGCCCGCGCGTTGG - Exonic
920559681 1:206930344-206930366 GTCCAGCACCGTGGCCGCCGAGG - Exonic
924524701 1:244835668-244835690 GCCCTGCACCGCCGGGGTCGCGG - Exonic
1062840166 10:663959-663981 GCTCAGCACTGCAGGCACCGAGG + Intronic
1062840198 10:664082-664104 ACTCAGCACCGCAGGCACCGAGG + Intronic
1063127568 10:3149138-3149160 GCCCAGCTCTGCCGTGGCCGAGG - Intronic
1063418119 10:5889905-5889927 GCCCAGGAACGCCGGCCCCCAGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064418092 10:15168207-15168229 GCCCATCCCCGCCGGCGGCCTGG - Intronic
1066337056 10:34488671-34488693 GCCCAGCACCGCTGTGGCCGGGG + Intronic
1067079081 10:43203514-43203536 GCCCAGCACCGCCGGTCCCGAGG + Intronic
1069024191 10:63521856-63521878 ACCCAGCGCCGCCGGAGCAGGGG - Intronic
1069590163 10:69636377-69636399 GCCCAGCACCGCCCCAGCCAGGG - Intergenic
1070877534 10:79827070-79827092 GCCCAGCCCCGCCCGCGGCGAGG + Intergenic
1071644029 10:87343116-87343138 GCCCAGCCCCGCCCGCGGCGAGG + Intergenic
1075369945 10:121927681-121927703 GCCCCGCTAAGCCGGCGCCGCGG + Intronic
1076833830 10:133010072-133010094 TCCCAGCACTGCCGGAGCTGGGG - Intergenic
1076890704 10:133281834-133281856 GCCCTGCGGCGCCGGCTCCGGGG - Intronic
1077143902 11:1036412-1036434 GCCCAGCACCGCGGCTGCTGGGG + Intronic
1077466097 11:2734437-2734459 GCCCAGCACAGCTGGCTGCGGGG - Intronic
1079459775 11:20669508-20669530 GCCCCCCACCGCTGGCGCGGCGG - Intergenic
1080387639 11:31819181-31819203 GCCGAGCACAGATGGCGCCGAGG + Intronic
1080628338 11:34051553-34051575 GCCCCACAGCGCCGGGGCCGGGG + Intergenic
1081804942 11:45885509-45885531 GCCCAGGGCCGCGGGGGCCGTGG + Intergenic
1083920861 11:65780894-65780916 GCCCGTTACCGCCGGCGCCGGGG - Intergenic
1084087792 11:66862534-66862556 GCCCAGCACAGCCCGCCCTGTGG + Intronic
1084588756 11:70078462-70078484 GCCCAGGCCCGCCGGGGACGTGG - Exonic
1084758296 11:71252518-71252540 GCCCAGCCCCGCCGGAGCTCAGG + Intronic
1085205827 11:74731359-74731381 TCCCAGCAGCGGCGGCGGCGCGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1091596966 12:1884815-1884837 GCTCATCAGCGACGGCGCCGTGG - Exonic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102159721 12:110758620-110758642 GCCCATCACTGCAGCCGCCGGGG + Intergenic
1102341583 12:112125905-112125927 GCCCAGCTCCGCCCGGGACGCGG - Exonic
1103415025 12:120737862-120737884 GTCCACCACCGCCCGGGCCGAGG + Exonic
1103505985 12:121442665-121442687 ACCCAGCACCGAAGGGGCCGAGG - Exonic
1103561284 12:121794354-121794376 GCCCGGAGCGGCCGGCGCCGAGG - Intronic
1103896857 12:124278742-124278764 GCCCAGCACAGCCCGAGCAGCGG - Intronic
1105291928 13:19058771-19058793 GCCCAGCACTGCCGGCAGGGTGG + Intergenic
1105425632 13:20292516-20292538 GGCCAGCCCTGCCGGCCCCGGGG + Intergenic
1107468170 13:40667263-40667285 GCCCCCCACCCCCGGCGCCGCGG + Intergenic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1111220941 13:85205181-85205203 GCCCAGCGCCCCCCGCCCCGTGG + Intergenic
1112112724 13:96320740-96320762 GCCCAGCATCCCCAGCGTCGGGG + Intronic
1113904957 13:113814891-113814913 CCCCAGCACCCCCTGCCCCGGGG - Exonic
1114192967 14:20454666-20454688 ACCCAGCACCGCCGGCATGGCGG + Exonic
1114523404 14:23352587-23352609 TCCCAGCACCCCCGCCCCCGCGG - Intronic
1120979685 14:90278955-90278977 GCCGAGCATCCCCGGTGCCGCGG + Intronic
1121252990 14:92513608-92513630 CCCCAGCACCCCCCGCCCCGAGG + Intergenic
1121279536 14:92688843-92688865 GCCAAGCACGGCCAGCTCCGCGG + Exonic
1122082279 14:99274263-99274285 GCCCAGCGCCGCCGGCGGTCCGG + Intergenic
1122577104 14:102749498-102749520 CCCCAGCACAGCCGGGACCGCGG + Intergenic
1122625737 14:103084515-103084537 ACCCACCACCCCCAGCGCCGCGG - Intergenic
1124128930 15:26967930-26967952 CCCCAGAACCTCCGGAGCCGAGG + Intergenic
1125524799 15:40368123-40368145 GCGCTGCACCGGCGGCTCCGCGG + Exonic
1126626064 15:50686767-50686789 GCCCGCCTCCGCCGGCGACGGGG + Exonic
1127165773 15:56243811-56243833 TCCCGGCCCCGCCGCCGCCGCGG + Intergenic
1128732983 15:70033635-70033657 GCCCAGCGCCCCAGGCGCGGGGG + Intergenic
1129691385 15:77715673-77715695 GCCCAGCCCCTCCTGCGCTGGGG + Intronic
1130023642 15:80251951-80251973 CTCCAGCCCCGCAGGCGCCGCGG + Intergenic
1130411723 15:83653830-83653852 GCCGAGTCCCGCCGTCGCCGCGG + Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132560225 16:590125-590147 GCCCCGCCCCGCCCGCGCCCGGG - Intronic
1133021173 16:2967591-2967613 GCCCCGCACCGTCGGCGCAGCGG - Exonic
1133272013 16:4614925-4614947 GCCTCGCTCCGCCGGCGCCGCGG + Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1135335736 16:21599691-21599713 TCGGATCACCGCCGGCGCCGGGG - Exonic
1136064858 16:27751855-27751877 GCCCAGCACGGCCGACGGCGAGG + Exonic
1136554028 16:30997401-30997423 GCCAAGCACCGGCGGGGGCGTGG - Intronic
1137618201 16:49858853-49858875 CCCCACCCCCGCCGGCGCCTGGG + Intergenic
1137731427 16:50693453-50693475 GCCCCGCAGCGCCGGCTCCAGGG - Intergenic
1138389955 16:56662989-56663011 ACCCAGGACCGCAGGCGCCGCGG - Intronic
1138390980 16:56669701-56669723 GCCCAGGACCGCGGGCGGCTCGG + Intronic
1138391849 16:56676011-56676033 ACCCAAGACCGCAGGCGCCGCGG + Intronic
1138514563 16:57528983-57529005 GGCCAGCAGCGCGGGCGCGGGGG + Exonic
1139853912 16:69965843-69965865 GCCCAGCCCGGCGGGAGCCGAGG - Intergenic
1139882890 16:70188756-70188778 GCCCAGCCCGGCGGGAGCCGAGG - Intergenic
1140369619 16:74406763-74406785 GCCCAGCCCGGCGGGAGCCGAGG + Intergenic
1141797998 16:86287362-86287384 GCCCAGCAGCGCGGGGCCCGGGG - Intergenic
1141831013 16:86510089-86510111 GCCGAGCGCCGCGGGCGGCGGGG + Intergenic
1143030318 17:3963996-3964018 GGCCACCTTCGCCGGCGCCGGGG - Intronic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1143485367 17:7251305-7251327 CCCCGGCACCGCCGGCCCCGGGG + Exonic
1143485380 17:7251336-7251358 GCCCAGCTCCGCCAGCCCCCCGG + Exonic
1145979982 17:29005660-29005682 GCCCGGCTTGGCCGGCGCCGGGG + Intronic
1146197371 17:30824825-30824847 TCCCAGCGCCGCCCGCCCCGCGG + Intergenic
1148388551 17:47253874-47253896 GCCCAGAGCGGCCGGGGCCGCGG - Intergenic
1148846908 17:50534774-50534796 GCCCAGCACTGGCGGGGCTGGGG + Intronic
1150086424 17:62275474-62275496 GGCCAACACCGCCCGCACCGTGG + Intronic
1151478545 17:74356881-74356903 GGCCAGCAGCGGCGGCGACGCGG - Exonic
1152924395 17:83080541-83080563 GCCCAGCGCAGCGCGCGCCGCGG - Intronic
1154160903 18:11980769-11980791 GCCCAGCCCCGGAGGTGCCGGGG - Intergenic
1156525638 18:37765032-37765054 GCCCAGCACCGTGGGGGCCAGGG + Intergenic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158190959 18:54828425-54828447 ACCCAGCCCCGCCGCCGCGGCGG + Exonic
1158259087 18:55588061-55588083 TCCGTGCACCGCCGGCGCCGAGG + Intronic
1160532657 18:79574677-79574699 GACCAGCACCGTCGGCAACGTGG + Intergenic
1160583774 18:79901692-79901714 GCCCCGCACTGCAGGGGCCGTGG - Intergenic
1160694300 19:475040-475062 GCCCAGCTCTGCCGGCTCCCGGG - Intergenic
1160763892 19:798588-798610 ACCCAGCACCGCGGGCTCGGGGG + Intronic
1161854239 19:6754383-6754405 GCCCAGCACCGCCAGCGCCCCGG + Exonic
1161976945 19:7612369-7612391 GCCAAGCACCGCCAGCGGCTGGG + Exonic
1162063626 19:8111486-8111508 CCGCAGCACCGCCTGGGCCGAGG + Intronic
1162341853 19:10096144-10096166 CCCGAGCAGCGCCAGCGCCGCGG + Exonic
1162778659 19:12995639-12995661 GCTCGGCCCCGCCGGCTCCGGGG - Exonic
1163520221 19:17787722-17787744 GCCCAGCACACCCAGCCCCGTGG + Exonic
1163525936 19:17821465-17821487 GCCCAGCAGCACCAGCGCCCAGG + Exonic
1164938673 19:32234071-32234093 GCCCAGCACTGCCAGCTCCCAGG + Intergenic
1166857887 19:45792397-45792419 GCCCAGCCCCGCGGGCGTGGCGG + Exonic
1166945015 19:46390997-46391019 GCCCAGCACCGTGGGCTCCTGGG + Intronic
1167610673 19:50506465-50506487 ACCCAGTGCCGCCGGCGCAGCGG + Exonic
1168694452 19:58396691-58396713 CACCAGCACCGCCAGCGCCACGG - Exonic
925836415 2:7951178-7951200 GCCCAGCTCTGCTGGCGCAGCGG + Intergenic
926090130 2:10044009-10044031 GCCCCGCCCCGCTGGCCCCGCGG + Intronic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
927638865 2:24834430-24834452 GCCCGGCACCACCGCAGCCGAGG + Intronic
927714289 2:25342123-25342145 GCTCCGCAGCGCCGGGGCCGGGG - Intronic
927935022 2:27071550-27071572 GGCCAGCCCCGCCGTGGCCGTGG - Intronic
932209265 2:69914385-69914407 GCCCAGAACCTCCAGGGCCGCGG + Intronic
932316895 2:70790582-70790604 GCCCAGGAGCGCGGGCGGCGCGG + Exonic
933777431 2:85779504-85779526 GCCCAGCACCCCCAGGGCCAGGG - Intronic
934079003 2:88452146-88452168 GCCCAGCTCCCCGGGCCCCGCGG + Exonic
934566991 2:95346625-95346647 CTCCAGCCCCGCGGGCGCCGGGG - Intronic
934717082 2:96550475-96550497 CCCCTTCCCCGCCGGCGCCGAGG - Intronic
934994610 2:98945894-98945916 GCTCAGCACTGCCGGCTCTGAGG + Intergenic
936126020 2:109789752-109789774 CCCCAGCACCGCTGGTGCCAGGG - Intergenic
936218673 2:110581716-110581738 CCCCAGCACCGCTGGTGCCAGGG + Intergenic
938469180 2:131543999-131544021 GCCCACCACCCCCGCCACCGTGG - Intergenic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
944221680 2:197310286-197310308 CCCCAGCCCCGCCGGGCCCGCGG + Intronic
944676065 2:202034697-202034719 GCCCAGCAGCGCCAGCACCAGGG - Exonic
945649134 2:212538053-212538075 AACCCGCACCGCCGGGGCCGCGG - Intronic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
948829988 2:240594007-240594029 TGCCAGCACCGCCGGCCCCAGGG - Exonic
1169074332 20:2752005-2752027 TCCCAGCGCCGCCGGGACCGGGG + Intronic
1171035428 20:21709371-21709393 GCACAGCTACGCCGGCCCCGGGG - Exonic
1175358518 20:58389128-58389150 GCCCTGCGCCGCCGGCTCCAGGG - Exonic
1175790655 20:61738080-61738102 GCCCGGCACCGCCTGCCCCAAGG - Intronic
1176566768 21:8392115-8392137 TCCGAGCCCCGCCGGCGGCGCGG - Intergenic
1177905287 21:26966249-26966271 GCCCAGCCCCGCCGGCGGCAGGG - Exonic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1180064356 21:45405203-45405225 CCCCAGGACCGTCAGCGCCGCGG - Intronic
1180198689 21:46212246-46212268 GCCCAGCACTGCCCGCCCCAGGG - Intronic
1180534540 22:16386771-16386793 GCCCCCCACCCCCGCCGCCGCGG + Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1182485357 22:30635741-30635763 GCCCGGCACGGCGGGCGCGGCGG - Exonic
1183931415 22:41238035-41238057 GCCTCGCCCCGCAGGCGCCGCGG + Exonic
1184286213 22:43473205-43473227 GCCCAGCAGCACGGGCACCGTGG - Intronic
1185219469 22:49622298-49622320 GCCCAGCTCAGCCCACGCCGGGG + Intronic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
954717532 3:52533920-52533942 GCCCCGCCCCGCCGGGTCCGGGG - Intronic
960115072 3:113885235-113885257 GCCCAGCTCCGCCAGCCCCCCGG - Intronic
961651488 3:128418706-128418728 GCCCAGCACCCCTGTGGCCGGGG + Intergenic
961674404 3:128555844-128555866 GCCCAGCGCCGCAGCCGCTGCGG - Intergenic
961698877 3:128726371-128726393 GCCCAGCCCGGCCGGCGGCCTGG + Intronic
964118969 3:153162643-153162665 GCGCAGCCCCGACGGGGCCGCGG + Exonic
964607038 3:158571170-158571192 GGCGGGCACCGCCTGCGCCGCGG + Intronic
968426528 4:527137-527159 GCCCAGCAGCCCCAGCGCCAGGG - Exonic
968907567 4:3461785-3461807 GCCCAGGACAGCCGGTGCGGAGG - Intergenic
972437214 4:39045246-39045268 GCCCAGCCCCTCCGGACCCGAGG - Intronic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984666021 4:182430759-182430781 TCCCAGCACTGCAGGAGCCGAGG + Intronic
985145164 4:186889056-186889078 TCCCAGCACCGTGGGCCCCGGGG - Intergenic
986733185 5:10649812-10649834 GCCCCGCAGCGCCCGCCCCGCGG + Exonic
989584813 5:43066507-43066529 GCCCAGCGCCGGCGTCGCCCGGG + Intronic
992078898 5:73216139-73216161 GCCCAGCATCGAGGGCGCGGCGG + Intergenic
992671908 5:79069679-79069701 CCCCCGCCCCGCCGGCCCCGCGG - Intronic
992690608 5:79236954-79236976 GCCGAGCTCCGCCGGGGCCCGGG - Exonic
994067083 5:95555310-95555332 GGCCAGTACCGCCAGCGCCAAGG - Exonic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007431486 6:41779822-41779844 GCCCGGCGCCGCCCGGGCCGCGG - Exonic
1008629348 6:53348635-53348657 CTCCAGCTCCGCCGGCTCCGGGG - Intronic
1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG + Intergenic
1017163850 6:151390519-151390541 GCGCAACAGCCCCGGCGCCGGGG + Intronic
1019016488 6:168884172-168884194 GCCCGGCACTGCCGACGCTGGGG - Intergenic
1019490705 7:1311915-1311937 GCCCAGCACCGCCGTCATCTGGG + Intergenic
1019574308 7:1729053-1729075 GCCCAGCTCCTCCTGCCCCGCGG + Intronic
1019765099 7:2844178-2844200 GCCGCGCCCCGCCGGCGCCCGGG + Exonic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020288817 7:6706743-6706765 CCCCAGCGCCGTCGGCTCCGGGG + Exonic
1020461370 7:8433564-8433586 GCTCAGCCCAGCCGGCGGCGAGG + Intergenic
1021027479 7:15686859-15686881 GCCCAGCACTGCCGGCTGCCAGG + Intergenic
1026727260 7:72879554-72879576 CCCCAGCGCCGCTGGCTCCGGGG - Exonic
1026928748 7:74211138-74211160 GCCCAGCCCTGCCGGCCCCTGGG + Intronic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1044257524 8:90082808-90082830 GCCCGGCAGCGCCCGCGCCCAGG - Exonic
1045115236 8:98973853-98973875 CCCCAGGACCGCCGGTGCCGGGG + Intergenic
1045306432 8:100960570-100960592 CACCAGCACCGCCGGCACGGTGG - Intergenic
1048330354 8:133466701-133466723 GCCCAGCAGTGCTGGGGCCGGGG - Intronic
1048980715 8:139702344-139702366 GCGCAGCCCAGCCCGCGCCGGGG + Intronic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1054342198 9:63876545-63876567 CCCCAGCAGGGCCGGCGCAGGGG + Intergenic
1055757759 9:79573179-79573201 GCCCAGCAGCGCCGCTGCCGAGG - Intronic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1058546853 9:106069684-106069706 CCCCAGCACCGCCGCCACCACGG - Intergenic
1059375230 9:113876168-113876190 GGCCCGCACCGGCCGCGCCGCGG - Intergenic
1060917121 9:127397924-127397946 GCCCAGCACTCCCCCCGCCGCGG - Exonic
1061090721 9:128424443-128424465 ACCAAGAACCGCCAGCGCCGGGG + Exonic
1061141338 9:128769025-128769047 GCCCAGCACTGCCAGCGCTTTGG - Intronic
1061483812 9:130910221-130910243 GACCAGCCCCGCTGGCCCCGGGG + Intronic
1061485611 9:130919122-130919144 GCCCAGCCCCGCGCCCGCCGTGG - Intronic
1061725592 9:132580481-132580503 CCCCAGCCCGGCCGGCGGCGGGG + Intergenic
1062049094 9:134437998-134438020 GCCCCGCACCACCGGAGCCCGGG - Intronic
1062060314 9:134491944-134491966 ACCCAGCACCTCCTGCACCGTGG - Intergenic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062425554 9:136504583-136504605 GCCCCTCACGGCCGGCGCCATGG - Intronic
1062640309 9:137515277-137515299 GCCCAGCATCGCCGCCGAGGCGG - Intronic
1203746029 Un_GL000218v1:41122-41144 TCCCAGCACCGCTGCCCCCGAGG + Intergenic
1203564085 Un_KI270744v1:78360-78382 TCCCAGCACCGCTGCCCCCGAGG - Intergenic
1185465221 X:350602-350624 GCCCAGCACTGGCGCCGGCGAGG + Intronic
1187341664 X:18426083-18426105 GCCCCTTCCCGCCGGCGCCGAGG + Intronic
1197962766 X:132023708-132023730 GCCCAGCACCGAGGGCGCACCGG - Intergenic
1199772639 X:150984152-150984174 GCCCCGGGCCGCGGGCGCCGGGG - Intronic
1200084801 X:153598921-153598943 GGCCAGGACAGGCGGCGCCGCGG - Intronic