ID: 947539310

View in Genome Browser
Species Human (GRCh38)
Location 2:230964275-230964297
Sequence CTGGGTCCCATCACCGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947539310_947539325 23 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539325 2:230964321-230964343 AGGAGCCCACGGAGGTGGGGAGG No data
947539310_947539321 15 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539321 2:230964313-230964335 GGCGGAGCAGGAGCCCACGGAGG No data
947539310_947539320 12 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539320 2:230964310-230964332 TCGGGCGGAGCAGGAGCCCACGG 0: 3
1: 3
2: 82
3: 529
4: 767
947539310_947539323 19 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539323 2:230964317-230964339 GAGCAGGAGCCCACGGAGGTGGG No data
947539310_947539324 20 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539324 2:230964318-230964340 AGCAGGAGCCCACGGAGGTGGGG No data
947539310_947539322 18 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539322 2:230964316-230964338 GGAGCAGGAGCCCACGGAGGTGG No data
947539310_947539329 29 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539329 2:230964327-230964349 CCACGGAGGTGGGGAGGCTCGGG No data
947539310_947539314 -6 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539314 2:230964292-230964314 ACCCAGAGCCACGGAGGCTCGGG No data
947539310_947539327 28 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data
947539310_947539319 3 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539319 2:230964301-230964323 CACGGAGGCTCGGGCGGAGCAGG No data
947539310_947539317 -3 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539317 2:230964295-230964317 CAGAGCCACGGAGGCTCGGGCGG No data
947539310_947539313 -7 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539313 2:230964291-230964313 GACCCAGAGCCACGGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947539310 Original CRISPR CTGGGTCCCATCACCGCCCA AGG (reversed) Intergenic
No off target data available for this crispr