ID: 947539315

View in Genome Browser
Species Human (GRCh38)
Location 2:230964293-230964315
Sequence GCCCGAGCCTCCGTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947539315_947539332 27 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539332 2:230964343-230964365 GCTCGGGCATGGCAGGCTGCAGG 0: 29
1: 225
2: 963
3: 623
4: 462
947539315_947539320 -6 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539320 2:230964310-230964332 TCGGGCGGAGCAGGAGCCCACGG 0: 3
1: 3
2: 82
3: 529
4: 767
947539315_947539321 -3 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539321 2:230964313-230964335 GGCGGAGCAGGAGCCCACGGAGG No data
947539315_947539330 16 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539330 2:230964332-230964354 GAGGTGGGGAGGCTCGGGCATGG No data
947539315_947539329 11 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539329 2:230964327-230964349 CCACGGAGGTGGGGAGGCTCGGG No data
947539315_947539323 1 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539323 2:230964317-230964339 GAGCAGGAGCCCACGGAGGTGGG No data
947539315_947539325 5 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539325 2:230964321-230964343 AGGAGCCCACGGAGGTGGGGAGG No data
947539315_947539322 0 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539322 2:230964316-230964338 GGAGCAGGAGCCCACGGAGGTGG No data
947539315_947539324 2 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539324 2:230964318-230964340 AGCAGGAGCCCACGGAGGTGGGG No data
947539315_947539331 20 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539331 2:230964336-230964358 TGGGGAGGCTCGGGCATGGCAGG No data
947539315_947539327 10 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947539315 Original CRISPR GCCCGAGCCTCCGTGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr