ID: 947539327

View in Genome Browser
Species Human (GRCh38)
Location 2:230964326-230964348
Sequence CCCACGGAGGTGGGGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947539310_947539327 28 Left 947539310 2:230964275-230964297 CCTTGGGCGGTGATGGGACCCAG No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data
947539316_947539327 9 Left 947539316 2:230964294-230964316 CCAGAGCCACGGAGGCTCGGGCG No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data
947539315_947539327 10 Left 947539315 2:230964293-230964315 CCCAGAGCCACGGAGGCTCGGGC No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data
947539318_947539327 3 Left 947539318 2:230964300-230964322 CCACGGAGGCTCGGGCGGAGCAG No data
Right 947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947539327 Original CRISPR CCCACGGAGGTGGGGAGGCT CGG Intergenic
No off target data available for this crispr