ID: 947539421

View in Genome Browser
Species Human (GRCh38)
Location 2:230964695-230964717
Sequence GGCCTCCCGCTGCACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947539421_947539432 21 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539432 2:230964739-230964761 CAGAGTGGGCGCAGAGGCCAAGG No data
947539421_947539428 7 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539428 2:230964725-230964747 TCCTCAAGCGCGGCCAGAGTGGG 0: 112
1: 206
2: 275
3: 731
4: 454
947539421_947539430 15 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539430 2:230964733-230964755 CGCGGCCAGAGTGGGCGCAGAGG No data
947539421_947539425 -3 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539425 2:230964715-230964737 GCCGAAGGGCTCCTCAAGCGCGG No data
947539421_947539433 24 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539433 2:230964742-230964764 AGTGGGCGCAGAGGCCAAGGAGG No data
947539421_947539427 6 Left 947539421 2:230964695-230964717 CCCACACAGTGCAGCGGGAGGCC No data
Right 947539427 2:230964724-230964746 CTCCTCAAGCGCGGCCAGAGTGG 0: 128
1: 291
2: 389
3: 812
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947539421 Original CRISPR GGCCTCCCGCTGCACTGTGT GGG (reversed) Intergenic
No off target data available for this crispr