ID: 947543117

View in Genome Browser
Species Human (GRCh38)
Location 2:230991912-230991934
Sequence CTGTGTGACGTGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947543107_947543117 25 Left 947543107 2:230991864-230991886 CCAGCTGGTGACCAGAGCAGGCA No data
Right 947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 175
947543110_947543117 1 Left 947543110 2:230991888-230991910 CCTCTCTATGGACCAGTGTCCCT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 175
947543108_947543117 14 Left 947543108 2:230991875-230991897 CCAGAGCAGGCATCCTCTCTATG 0: 1
1: 0
2: 0
3: 16
4: 105
Right 947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947543117 Original CRISPR CTGTGTGACGTGAAGGTGAA GGG Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
901559629 1:10059720-10059742 CTGTGACACGTGGAGGTGAGAGG - Intronic
903039958 1:20522088-20522110 CTTTGTGAGGTGAAGTTGCAGGG + Intergenic
905382352 1:37571969-37571991 CTGTGTGTCCTGATGCTGAAAGG - Intronic
905710918 1:40102239-40102261 CTTTGTGAGGTCAAGGTGAATGG + Intergenic
905814060 1:40934393-40934415 CTTTGGGACGTGAAGGTGGGAGG - Intergenic
906477807 1:46181559-46181581 CTGTATGACGGGGAGCTGAAAGG + Intronic
909476146 1:76082751-76082773 CTGTGTGATGTGGAGGTGTGGGG + Intronic
911226050 1:95306870-95306892 CTGTGTGCCGTCAAGTTGAGGGG - Intergenic
913662593 1:121017864-121017886 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
914013980 1:143801125-143801147 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
914163843 1:145160072-145160094 CTCTGTGAGGTCAATGTGAAGGG + Intergenic
914652598 1:149709681-149709703 CTCTGTGAGGTCAATGTGAAGGG - Intergenic
915892042 1:159781602-159781624 CTGTGAGTTGTGAAGGAGAAGGG + Intronic
917097884 1:171417796-171417818 CTGTGGGAGGACAAGGTGAAAGG - Intergenic
919324558 1:196090290-196090312 CTGTCTGAGGTGAAGCAGAAAGG + Intergenic
921056047 1:211543153-211543175 CTGTGGGCAGTGAGGGTGAATGG + Intergenic
921821293 1:219620183-219620205 CTGTGTAACGTGAAGGTCCTTGG - Intergenic
1063611767 10:7568826-7568848 CTGTGTGCCGTGAACATGTATGG - Intronic
1064629036 10:17290653-17290675 CTGCAAGAAGTGAAGGTGAATGG - Intergenic
1065179761 10:23113146-23113168 TTGTGTGGAGTGAAAGTGAAGGG + Intronic
1065386535 10:25139184-25139206 CTTTGAGAGGTCAAGGTGAAAGG - Intergenic
1072497687 10:95978613-95978635 CTTTGTGAGGCCAAGGTGAAAGG - Intronic
1076178236 10:128385278-128385300 CTGTGTGCTGAGGAGGTGAATGG - Intergenic
1076686267 10:132199782-132199804 CTCTGAGGCGTGCAGGTGAATGG + Intronic
1077262319 11:1629381-1629403 CTGTGGACCGTGAAGGTGTAGGG + Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1080697924 11:34619316-34619338 TTGTGTGTAGTGATGGTGAAGGG - Intergenic
1080740460 11:35059134-35059156 CTGTGTGACATGAAAGTCATGGG + Intergenic
1083405869 11:62456675-62456697 CTGTGGGACATGAAGTTGATGGG - Intronic
1085182932 11:74551291-74551313 CTGAGTGCCATGAAGGGGAAGGG - Intronic
1088083103 11:105944386-105944408 CTGTGAGACATGAAGGAGAGTGG - Intronic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1088962641 11:114684826-114684848 CAGTGTGACAGGAAGTTGAATGG + Intronic
1090081546 11:123616785-123616807 CTGTGCTAAGTGAAGGTCAAGGG - Intronic
1091298442 11:134489605-134489627 CTGTGTGACCTGAAGTTGTCAGG - Intergenic
1091298457 11:134489671-134489693 CTGTGTGACCTGAAGTTGTCAGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092725451 12:11481116-11481138 ATGTGTCAAGAGAAGGTGAAAGG + Intronic
1095473936 12:42566007-42566029 CTGTGTGGCGAGATGGTCAAAGG + Intronic
1096713461 12:53475661-53475683 CTGTGTGCTGTGAAGGGTAAAGG + Intronic
1097723783 12:63051520-63051542 CTGTGTGGCGTGACGGTGGCTGG + Intergenic
1098600315 12:72323737-72323759 CTGTGGGAATTGAAGGTCAAAGG + Intronic
1102425492 12:112840936-112840958 GTGTGTGATGTGAATGGGAATGG - Intronic
1102499330 12:113340608-113340630 CTTTGGGAAGTCAAGGTGAAGGG + Intronic
1104211819 12:126696221-126696243 CTTTGAGAAGGGAAGGTGAAGGG - Intergenic
1104350161 12:128038506-128038528 CCGTGTGGTGTGAAGGTCAAAGG + Intergenic
1104766486 12:131333455-131333477 CTGAGTGTCGGGAAGATGAATGG - Intergenic
1105249298 13:18682685-18682707 CTGTGTGACGTTGAGGTTTAGGG - Intergenic
1105981378 13:25519550-25519572 CTGGGTGACATGAAGATGACCGG - Intronic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1106394097 13:29363714-29363736 ATATGTGAACTGAAGGTGAAAGG - Intronic
1113798746 13:113075576-113075598 CTCTGAGAGGTGAAGGTGAGAGG - Intronic
1116812320 14:49551305-49551327 CTGTGTAAAGTTAACGTGAAAGG + Intergenic
1117745773 14:58867891-58867913 CTTTGGGAGGTCAAGGTGAAAGG - Intergenic
1118920356 14:70144235-70144257 TTGTGTCACATGGAGGTGAATGG - Intronic
1119896749 14:78226244-78226266 CTTTGGGATGTGAAGGTGAGTGG - Intergenic
1120384566 14:83827819-83827841 CTGTGTGAAGGTAAGGTAAAGGG + Intergenic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1121994861 14:98593733-98593755 CTGTGGGATGTGAAGCTGACTGG - Intergenic
1125916586 15:43493158-43493180 TTGTGTGACGTGACGGGAAAGGG - Exonic
1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG + Intergenic
1129616912 15:77105937-77105959 CTGGGTGATGTGATGGGGAAGGG + Exonic
1133978395 16:10616791-10616813 CTGGGTGACTTGAGGGTGAAGGG - Intergenic
1142372134 16:89688580-89688602 CCGTGTGACTTCCAGGTGAAAGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142984536 17:3688016-3688038 CGCTTTGACGTGATGGTGAACGG - Exonic
1144015766 17:11194130-11194152 CTGAGTGATGTGAAGATCAATGG + Intergenic
1146208288 17:30922702-30922724 CTGCGCGACGTGGAAGTGAAGGG - Intronic
1147854577 17:43469384-43469406 ATGAGTCACGTGAAGTTGAAGGG + Intergenic
1149596748 17:57868702-57868724 CTGTGTGGCGGGGAGGTGAGGGG + Intronic
1151182866 17:72342583-72342605 ATGTGTGACGTGGGGGTGAAGGG - Intergenic
1153245276 18:3067212-3067234 CTGTGTGACTTGGGTGTGAATGG - Exonic
1155120356 18:22813061-22813083 CTGTGTGACCTGATGGGCAAGGG - Intronic
1156608837 18:38702205-38702227 ATGTGTGACTTGAAGTAGAAAGG + Intergenic
1157010263 18:43639798-43639820 CTGTTCGAGGTCAAGGTGAAAGG + Intergenic
1161519479 19:4715733-4715755 ATGTGGGAGGTGCAGGTGAAAGG + Intronic
1164906363 19:31971556-31971578 CCGAGGGACGTGATGGTGAATGG - Intergenic
1165197321 19:34114732-34114754 CTTTGGGAGGCGAAGGTGAAAGG + Intergenic
1165971650 19:39636882-39636904 CTGTGTGAGGTACAGGTGATTGG - Intergenic
1166158959 19:40937331-40937353 CTGTGGGACATGTAGGTGACGGG + Intergenic
1166167906 19:41005253-41005275 CTGTGAGACATGTAGGTGAAGGG + Intronic
1166702327 19:44889240-44889262 CTGTGGGATGTGAAGGGGATGGG + Intergenic
924988509 2:291092-291114 CTGTGAGACGTGAATGTGCCTGG - Intergenic
925076128 2:1017774-1017796 CTGTGTCAGGTGAATGTTAAAGG + Intronic
929580572 2:43079530-43079552 CTGTATCACATGAAGGTGCATGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
933382612 2:81568816-81568838 CTTTGGGAGGTTAAGGTGAAAGG + Intergenic
935782400 2:106519662-106519684 CTGTGTTACACGAAGGTGGACGG - Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937569947 2:123344656-123344678 CTTAGTGACTTGAATGTGAAAGG - Intergenic
938971816 2:136439654-136439676 CTGTGCGACCTCAAGGTGAGAGG - Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
944611724 2:201416142-201416164 CTTTGGGAGGTCAAGGTGAAAGG + Intronic
944837002 2:203589753-203589775 CTGTGTGAAGTTAAGGTAACAGG + Intergenic
945671413 2:212806695-212806717 ATGTGTGACCTGAAGAAGAAAGG - Intergenic
946602868 2:221371315-221371337 ATGTGTGACGTGGATGTGGAGGG - Intergenic
946760971 2:222992774-222992796 CTGAGTGGCATGTAGGTGAACGG + Intergenic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1174755723 20:53156429-53156451 ATGTGTGACTTGAATGTAAAAGG - Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1184028864 22:41879102-41879124 CTTTGGGACGTCAAGGTGAGAGG - Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
949437111 3:4041417-4041439 TTGTGTCAGGTGAACGTGAAAGG - Intronic
949456947 3:4249006-4249028 CAGTGAGAAGTGAAGGAGAAGGG - Intronic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
953799908 3:46014812-46014834 CTGTGAGACGTGAAAATGTATGG + Intergenic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
960315749 3:116174609-116174631 CTGGTTGAAGTGAAGGAGAAGGG - Intronic
962601346 3:136993230-136993252 CTGAGTGATGTGCAGGAGAATGG - Intronic
966290781 3:178355561-178355583 GTGTGTGAGGTGGAGTTGAAGGG - Intergenic
967352135 3:188525524-188525546 CTATGTAAGGTTAAGGTGAAGGG + Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
970029637 4:11660305-11660327 CTGTGTGATTTGCAGATGAAGGG - Intergenic
972264375 4:37444882-37444904 CTCTGTGACATGCAGGTGACTGG - Exonic
972336633 4:38112829-38112851 CTGTGTGACCTGACTGTGGATGG + Intronic
977344543 4:95800662-95800684 CTTTGGGAGGTGAAGGTGAGAGG - Intergenic
977853586 4:101860278-101860300 CTGTGTGACGGTAAGGTCATGGG + Intronic
981108650 4:140910611-140910633 CTGTAGGACGTGGATGTGAATGG - Intronic
984161983 4:176263977-176263999 ATGTGTGACCTTAAGCTGAATGG - Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986806350 5:11312014-11312036 GTGTGTGGGGTGAAGGTGTATGG - Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
990381095 5:55222628-55222650 CTGTGTGACGTGCAGGCCCAGGG - Intronic
990917950 5:60931550-60931572 CTTTGGGAGGTGAAGGTGAGAGG - Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
995130856 5:108629137-108629159 CTCTGTGAGGTGAAGGTATACGG - Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
1000793873 5:165640396-165640418 AAGTATGAAGTGAAGGTGAAGGG + Intergenic
1002185037 5:177450434-177450456 CTGAGTGACGTTTTGGTGAATGG + Intronic
1002642839 5:180638654-180638676 CTGGAGGACGTGAATGTGAAGGG - Intronic
1002823974 6:755867-755889 CTCTTTGACCTGAAGGGGAAAGG - Intergenic
1003445912 6:6184306-6184328 CGGTGTGCCGTGAAGGCCAAGGG - Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1003790886 6:9546179-9546201 CTGTATGAAGAGAATGTGAAAGG + Intergenic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1007162868 6:39806421-39806443 CTATGTGCCTTGAAGGTGAAGGG + Intronic
1009346770 6:62622644-62622666 AATTGTGAAGTGAAGGTGAAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1015381099 6:132570358-132570380 CTGTGCTACGCGAACGTGAATGG + Exonic
1016863568 6:148745974-148745996 CTATGGGACGTGAAGGAAAAGGG + Intergenic
1017918653 6:158853030-158853052 ATGTGTGACATGAAGGTGTATGG - Intergenic
1019116880 6:169772156-169772178 CTGTGTTACGACAAGGTGAAGGG - Intronic
1021165407 7:17333606-17333628 CTGTGTGAGGTGAAAATGATAGG + Intronic
1024984915 7:55186485-55186507 CTGTGTGATGTGAACGTGCTGGG - Intronic
1027047708 7:75002167-75002189 CTTTGGGAGGTGGAGGTGAATGG - Intronic
1029385288 7:100239481-100239503 CTTTGGGAGGTGGAGGTGAATGG + Intronic
1031552131 7:123128022-123128044 TTGTGTGAAGTGAGGGGGAAGGG - Intronic
1031737798 7:125388665-125388687 CTGTGTGAAGGGCATGTGAATGG + Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032437603 7:131913057-131913079 CAGTGTGAGGTGAGGGTGAGGGG + Intergenic
1032904204 7:136345744-136345766 CTGTGTCTCTTGAAGGGGAAAGG - Intergenic
1034390535 7:150784130-150784152 CTTTGGGAAGTTAAGGTGAAAGG + Intergenic
1035925143 8:3720144-3720166 CTGTGTGCGGTGAAGTTTAACGG - Intronic
1037693743 8:21206112-21206134 CTGGGTGAAGTGAAGGTCATGGG - Intergenic
1038005605 8:23427362-23427384 CTGTGTGACTGGAAGGGGAAAGG - Intronic
1039085136 8:33772252-33772274 CTGTGTGAAGGCAAGGTGAGAGG + Intergenic
1041063057 8:54054708-54054730 CTGTAATACGTGAAGGTAAAGGG + Intronic
1041108905 8:54467322-54467344 CTCGGGGACTTGAAGGTGAAGGG + Intergenic
1041407605 8:57517417-57517439 CTGAGTGCCGTGCAGGTCAAAGG + Intergenic
1042731973 8:71946013-71946035 TTGTGTGGTGTGAAGGTGATGGG - Intronic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1045495691 8:102706466-102706488 CTGTGTGAGGTTACAGTGAAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051850672 9:21503845-21503867 CGGTGGGAGGTGAAGCTGAAAGG + Intergenic
1053477001 9:38389634-38389656 CTGTGTGGATTGAAGGGGAAAGG - Intergenic
1055321906 9:75090419-75090441 CTTTCTGATGTGAAGGAGAAAGG - Intronic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1059429875 9:114243546-114243568 CTGGATGGCGTGAAGGTGAGGGG + Exonic
1059868043 9:118538592-118538614 ATGTATGACGTGCAGGTGGAGGG - Intergenic
1061210919 9:129192617-129192639 CTGTGTGAGGTTGAGGTGAGAGG + Intergenic
1061343498 9:130002880-130002902 CAGTGTGAGGTCAAGGTCAAGGG - Intronic
1062731342 9:138111808-138111830 CTGTGTGCCCTGAAGGTAAAAGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186173082 X:6898116-6898138 CAGTGAGATGTGAAGGTGAAAGG + Intergenic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192442995 X:71188797-71188819 CTGTGAGAGGTCAAGGTGAATGG + Intergenic
1193836071 X:86345673-86345695 CTGTGTGACTTGAGGCTGCATGG - Intronic
1198404879 X:136302333-136302355 CTCTGTGAAGTGATTGTGAATGG + Intronic