ID: 947549671

View in Genome Browser
Species Human (GRCh38)
Location 2:231037470-231037492
Sequence GGGGCGTGTCCTCTGTGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947549655_947549671 14 Left 947549655 2:231037433-231037455 CCCGGGGGCCCGGGGGTCCGGCT 0: 1
1: 0
2: 4
3: 30
4: 284
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549652_947549671 18 Left 947549652 2:231037429-231037451 CCCGCCCGGGGGCCCGGGGGTCC 0: 1
1: 0
2: 4
3: 32
4: 382
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549651_947549671 19 Left 947549651 2:231037428-231037450 CCCCGCCCGGGGGCCCGGGGGTC 0: 1
1: 0
2: 3
3: 26
4: 267
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549653_947549671 17 Left 947549653 2:231037430-231037452 CCGCCCGGGGGCCCGGGGGTCCG 0: 1
1: 0
2: 2
3: 22
4: 218
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549661_947549671 5 Left 947549661 2:231037442-231037464 CCGGGGGTCCGGCTGGGCTCGGC 0: 1
1: 0
2: 3
3: 25
4: 273
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549656_947549671 13 Left 947549656 2:231037434-231037456 CCGGGGGCCCGGGGGTCCGGCTG 0: 1
1: 1
2: 7
3: 44
4: 420
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549664_947549671 -3 Left 947549664 2:231037450-231037472 CCGGCTGGGCTCGGCCCTCGGGG 0: 1
1: 0
2: 5
3: 27
4: 232
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
947549659_947549671 6 Left 947549659 2:231037441-231037463 CCCGGGGGTCCGGCTGGGCTCGG 0: 1
1: 0
2: 2
3: 20
4: 265
Right 947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947549671 Original CRISPR GGGGCGTGTCCTCTGTGCCG GGG Exonic
900130369 1:1084789-1084811 GGGGCTTGTCCCCTCTGCTGAGG - Intronic
900237946 1:1601364-1601386 GGGGCCTGACCGCTGGGCCGGGG - Intergenic
900428024 1:2589300-2589322 GAGGCGTGTCCTCTCAGCCTTGG + Intronic
900631225 1:3636613-3636635 GGGCAGTGCCCTCTGTGCCTGGG + Intronic
900974420 1:6008219-6008241 GGGGCGGGTCCTTTCTGCCATGG - Intronic
903809730 1:26028638-26028660 GGAGCCTGTCCTCTGGGCCAGGG + Intronic
907223853 1:52927213-52927235 GGGGCGCGTCCTGTGGGGCGGGG - Exonic
917534703 1:175865774-175865796 GGGTCGTTCCCACTGTGCCGGGG + Intergenic
917627673 1:176862445-176862467 TGGACATGTCCTCTGTGCAGTGG - Exonic
917928269 1:179806691-179806713 GGGGCCTTTCCTCTGAGCCAGGG + Intronic
920190727 1:204191996-204192018 GGGCCGTGTCCTCTGTGCTCTGG + Intronic
921183182 1:212647205-212647227 GGGGTGTGAACTCTGTGCTGGGG - Intergenic
1071230624 10:83580902-83580924 GGGCTGTGTCCACTGTGCTGAGG - Intergenic
1075467417 10:122662038-122662060 GGGGGGTGTCCTCAGTGTGGGGG + Intergenic
1076535497 10:131174276-131174298 TGGGCTTGTCCTGTGTGCTGGGG - Intronic
1077101298 11:823743-823765 GGTCCTTGTCCTCTGGGCCGTGG - Exonic
1077176695 11:1194364-1194386 GGGGCGCGCCCGGTGTGCCGCGG + Intronic
1080475196 11:32583857-32583879 GTGGAGTGTCCGCTGTGCCCGGG + Exonic
1083171865 11:60927921-60927943 TGGGGGTTTCCTCTCTGCCGCGG - Intronic
1083276716 11:61601052-61601074 TGGGCGTGGCCTCTGTGTCCTGG - Intergenic
1083987606 11:66226498-66226520 GGGGCCTGTCCTGTGTACTGTGG - Intronic
1084146571 11:67268058-67268080 GGGGCCTGTCCACACTGCCGTGG + Intronic
1084322348 11:68380669-68380691 GGGGCGTGTCCTGCATGCAGTGG + Intronic
1085048539 11:73367622-73367644 GGGGCGGGGCCTCGGTGCCAAGG - Exonic
1089401829 11:118168803-118168825 GGGGCAAGCCCTCTGTGCCTGGG + Intronic
1091273028 11:134331685-134331707 GGGGCGGGTCCCCAGTGTCGTGG - Intergenic
1096489671 12:52006832-52006854 GGGGAGGGTCCTCCGTGCTGGGG + Intergenic
1102589818 12:113948807-113948829 GGGGTGTGGCCTCCGGGCCGTGG - Intronic
1106798225 13:33229785-33229807 GGGGCTTGTCCTCAGGGCCAGGG - Intronic
1113454807 13:110440747-110440769 GAGGCGTGTGCTGTGTGCTGTGG - Intronic
1122328755 14:100899057-100899079 GGATCGTGTCATCTGTCCCGTGG + Intergenic
1122862225 14:104587802-104587824 GGGGCTTGGCCTCTGGGCGGTGG - Exonic
1123024398 14:105417887-105417909 GGGGTGTGTCCTCTCCGCTGGGG + Intronic
1123036469 14:105473933-105473955 TGGGCGTGCCCTCTGTGCCCCGG - Intronic
1123047605 14:105526515-105526537 GGGGCGGGGCCTCTGGGTCGGGG + Intergenic
1127790184 15:62391825-62391847 GGGGCGTGTTCCCTGAGCCTCGG - Intronic
1128972131 15:72117569-72117591 GGGGCGTCTCCGCTGGGACGGGG + Intronic
1132715596 16:1288600-1288622 GGCAGGTGTCCTGTGTGCCGGGG - Intergenic
1133229089 16:4358034-4358056 GGAGCCTGTGCTCAGTGCCGAGG - Exonic
1133711652 16:8407391-8407413 GGGGGATGTCCTGTGTGCTGTGG - Intergenic
1136677346 16:31922980-31923002 AGGGTATGTCCTCTGTGCCCAGG - Intergenic
1138456622 16:57124851-57124873 AGGGCCTGGCCTCTGTGCAGGGG - Intronic
1138492285 16:57383515-57383537 GGGGCGTGGGCTCTGTACAGAGG - Exonic
1141987095 16:87587233-87587255 GAGGAGTGACCTCTGTGGCGGGG + Intergenic
1142285064 16:89168328-89168350 GCTGCGTCTCCTCTGTCCCGGGG + Intergenic
1142407783 16:89900825-89900847 GGGGTGTGTCCTGTCAGCCGTGG + Intronic
1142498955 17:321671-321693 GGGGCAGGTGCTGTGTGCCGGGG + Intronic
1144275953 17:13668158-13668180 GGGGCTTGTCCTCAGTTCCCTGG - Intergenic
1144710487 17:17398587-17398609 GGATGGTGTCCTCTGTGCCCAGG + Intergenic
1145001160 17:19305704-19305726 GGTGCCTGTACTCTGTGCTGGGG - Intronic
1147677619 17:42218918-42218940 GGGGCCTGGCGTCTGTGCGGAGG - Intronic
1148970404 17:51475780-51475802 GGAGCCTGTCCTCTGAGCCTGGG + Intergenic
1154181667 18:12144257-12144279 GGGGCTGGTCCTCTGGGCCTGGG - Intergenic
1154182237 18:12147327-12147349 GGGGCTGGTCCTCTGGGCCTGGG + Intergenic
1156521091 18:37722864-37722886 GGGACCCGTCCTCTGTGCAGGGG + Intergenic
1159015863 18:63101327-63101349 GGGTCGGGTCCGCTGTGCCCAGG - Intergenic
1161186901 19:2927135-2927157 GGGGAGTGGCATCTGTGGCGGGG + Intergenic
1161514613 19:4689665-4689687 GCGGCGTGTCCTTGGTGCCCTGG + Exonic
1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG + Intronic
1165135792 19:33667648-33667670 GGGGAGTGTCGTCTGTGCTGCGG - Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1167040543 19:47020589-47020611 GGGGCGGGTCCTCGGGGCAGAGG + Intronic
1167489075 19:49781541-49781563 AGGGTGTGTGCTCTGTGCTGTGG + Intronic
925132618 2:1504225-1504247 GGGGCGTCTGCGCTGTGCTGGGG + Intronic
927855084 2:26522879-26522901 GAGGGGTGTCCTCTTTGCCATGG - Intronic
927945793 2:27134450-27134472 GCGGCATGTCCTGGGTGCCGCGG - Exonic
929706338 2:44216335-44216357 GGGGGCTGTCCTGTGTGCTGTGG - Intronic
931676222 2:64699199-64699221 GGGGCATGACCACTGTGCAGCGG + Intronic
932412187 2:71554060-71554082 GGTTGGTGTCCTCTGTGCCTTGG + Intronic
934752475 2:96802334-96802356 GGTGCGTCTCCTCTTGGCCGTGG - Intronic
936513720 2:113168556-113168578 GTTGTGTGTCCTCTGTGCCGTGG + Intronic
938168746 2:129056613-129056635 GGTGCCTGTCCTCTGTGGGGAGG - Intergenic
938235627 2:129704193-129704215 GGGGCCTGGCCTCTGAGCAGTGG - Intergenic
944589551 2:201204127-201204149 GGTGCGTGTCCTCTATGGAGTGG + Intronic
947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG + Exonic
947632623 2:231663784-231663806 GGGACAGGTCCTCTGTGCCGTGG - Intergenic
948477815 2:238231705-238231727 GGGGCGTGGCCTCCGGGCCGCGG + Intergenic
948482928 2:238261782-238261804 GGGCCTTCTCCTCTGTGCAGGGG + Exonic
948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG + Intronic
948863431 2:240763811-240763833 GGGGCAGGTCCCCTGTGCCCAGG + Intronic
948991709 2:241559004-241559026 CGGGCGTGGCGTCCGTGCCGGGG + Intronic
1168997609 20:2144839-2144861 AGGGCGTGCCCTGTGTGCCGGGG + Exonic
1172012590 20:31854559-31854581 TGGGGGTGTCCTGTGTGCCAGGG - Intronic
1172118128 20:32583734-32583756 GGGGCGTCCCCTCTGGCCCGGGG - Intronic
1174089776 20:48037776-48037798 GGGGCTTTTGCTGTGTGCCGTGG + Intergenic
1175945250 20:62555603-62555625 GGTGTGTGTCCTCTCTGCCTTGG + Intronic
1176261118 20:64180990-64181012 AGGGCATGTCCTCTATGCCCAGG - Intronic
1177811674 21:25931295-25931317 GCAGCTTGTCCTCTGTGCCTCGG - Intronic
1183108907 22:35634163-35634185 AGGGCGTGTCCTTTGTGTCAGGG - Intronic
1183664231 22:39238131-39238153 GGGGCATCTCCTATGTGTCGTGG - Intronic
1185143826 22:49118659-49118681 GGTGCCCGTCCTCTGTGCCAGGG - Intergenic
1185201134 22:49506173-49506195 GGGGCAGGTGCTCAGTGCCGAGG - Intronic
952754799 3:36856809-36856831 GGGGCTTGTCCTGTGTCCTGCGG - Exonic
955081767 3:55664448-55664470 TGGGGGTGCCCTCTGTGCCCAGG - Intronic
956049294 3:65230411-65230433 AGGGTGTGTCCTCCGTGCAGAGG + Intergenic
961325115 3:126105059-126105081 GGAGCCTGTGCTGTGTGCCGGGG + Intronic
963127010 3:141825767-141825789 GGGGCGTGTTCTCTGGGGGGTGG - Intergenic
968514848 4:1011714-1011736 GGGGCGAGTCCGCGGGGCCGGGG - Intronic
968757835 4:2426068-2426090 GGTGCCTGTGCTCTCTGCCGTGG + Intronic
979530571 4:121765258-121765280 GGCGCGTTTCCTCGGAGCCGGGG - Intronic
985573825 5:664607-664629 GAGGCCTGTCCTGTGTGCAGCGG - Exonic
994049826 5:95349663-95349685 TGGGAGTGTCCTCTCTGCTGTGG - Intergenic
1002683444 5:180988251-180988273 GGGGCATGGCCTGTGTGCCTGGG + Intergenic
1005883225 6:30075512-30075534 GCGACGTGTCCTCTGTGCGGGGG - Exonic
1005886604 6:30102176-30102198 GGGGCGGGGCCTGCGTGCCGGGG - Intergenic
1008096909 6:47348472-47348494 TGGGCGTTTACTCTGTGCCAGGG - Intergenic
1013590932 6:111619194-111619216 AGGGCATGTCCTCTGTGGGGAGG + Intergenic
1013638428 6:112050286-112050308 GTGGGGTGTGCTCTGTGCGGGGG + Intergenic
1015152705 6:130056470-130056492 GGTGCTTCTCCTCAGTGCCGGGG + Intronic
1018061160 6:160090958-160090980 GGAGCGGGTGCTCTGTGCCCTGG + Intronic
1018061166 6:160091002-160091024 GGAGCGGGTGCTCTGTGCCCTGG + Intronic
1018061172 6:160091046-160091068 GGAGCGGGTGCTCTGTGCCCTGG + Intronic
1019326503 7:441075-441097 GGAGCGTGGCCTGTGTGACGTGG + Intergenic
1019326521 7:441152-441174 GGAGCGTGGCCTGTGTGACGTGG + Intergenic
1019326541 7:441229-441251 GGAGCGTGGCCTGTGTGACGTGG + Intergenic
1019326580 7:441385-441407 GGAGCGTGGCCTGTGTGACGTGG + Intergenic
1019360657 7:602656-602678 TGGGCGTTTCCTCTGTGGGGTGG + Intronic
1019547542 7:1585765-1585787 GGGCCGTGTGCTCTGGGCAGTGG + Intergenic
1019659845 7:2218171-2218193 GGGGCGGGGGGTCTGTGCCGTGG - Intronic
1032455976 7:132073850-132073872 GGGGCCTGCTCTCTGTGCTGTGG + Intergenic
1034622009 7:152463846-152463868 GGGCCGGGTCCTCTGGGCTGAGG + Intergenic
1039618271 8:38974332-38974354 GGTGCCCGTCCTCTGGGCCGGGG + Exonic
1049094896 8:140542741-140542763 GGGGGGTCCCCTCTGTGCCCTGG + Intronic
1049305117 8:141898638-141898660 GGGGCCTCGCCTCTGTGCTGTGG - Intergenic
1049365677 8:142235805-142235827 TGAGCGTTTCCTCTGTGCCAGGG + Intronic
1049372597 8:142274911-142274933 GGGGGGTGTCCTCAGGGCGGGGG - Intronic
1049375846 8:142288685-142288707 GGGGCATGTTCTCTGGGCTGGGG + Intronic
1058979071 9:110152499-110152521 GGGGCATGTCCTCTTGGCCAAGG + Intronic
1061003847 9:127917210-127917232 GGGGCGGGGCCTCAGGGCCGGGG + Intergenic
1061486001 9:130920789-130920811 GGGGTCTGTCCTCTGGGCCCTGG + Intronic
1062609935 9:137369145-137369167 GGGGCGGGGCCTCAGGGCCGTGG + Intronic
1185448541 X:271163-271185 GGGACGTGTCGTCCGTGCCTCGG - Intergenic
1185506527 X:635389-635411 GAGGGGTGTCCTCTGTCCCTAGG + Intronic
1187190768 X:17032717-17032739 GGGGCATGTCCTCTGGGTCCTGG + Intronic
1189285328 X:39848172-39848194 GGGGCGCTTCCTCTGTCTCGTGG - Intergenic
1193532432 X:82671857-82671879 TGGGCTTGTCCTCTCTGCCAAGG - Intergenic
1200156988 X:153982104-153982126 GGCCGGTGGCCTCTGTGCCGTGG + Exonic
1200162218 X:154015409-154015431 GGGGCGGTTCCTGTGTGCTGTGG - Intronic