ID: 947550382

View in Genome Browser
Species Human (GRCh38)
Location 2:231041419-231041441
Sequence CCCCGACCTCCTGCATCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947550377_947550382 21 Left 947550377 2:231041375-231041397 CCAGGATGTTGCTGCCTGCAGAA 0: 1
1: 0
2: 2
3: 31
4: 272
Right 947550382 2:231041419-231041441 CCCCGACCTCCTGCATCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 254
947550380_947550382 7 Left 947550380 2:231041389-231041411 CCTGCAGAAGCTCAGCTCAGGGT 0: 1
1: 0
2: 2
3: 21
4: 238
Right 947550382 2:231041419-231041441 CCCCGACCTCCTGCATCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947550382 Original CRISPR CCCCGACCTCCTGCATCCTG AGG Intronic
900097500 1:945956-945978 CCCCAACCTAGTGCAGCCTGGGG + Intronic
900365272 1:2309669-2309691 CCCCCACCTCCTCCTCCCTGTGG + Exonic
900391271 1:2435013-2435035 GCCCGGCCTGCTGCATGCTGAGG - Intronic
900474217 1:2868726-2868748 CCACGCCCTCCTGCCTCCTGTGG - Intergenic
901288733 1:8104880-8104902 GCCCTACTTCCTGCATCCAGTGG + Intergenic
901778588 1:11577504-11577526 CCCCAAGGTCCTGCATCCTCTGG + Intergenic
903164925 1:21513670-21513692 CCCCCACCCCCTGCAGCCTTAGG - Intronic
903539065 1:24086617-24086639 CCCCGACCCCCGGCATCAGGAGG + Intronic
904684611 1:32251225-32251247 CCCTGACTTCCTGCCTCCTCCGG - Exonic
905516999 1:38569356-38569378 CCCCTCCCTCTAGCATCCTGTGG + Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906545815 1:46618702-46618724 CCCCACACTCCTGCAGCCTGGGG - Intergenic
907251500 1:53142541-53142563 CTCCGACCACCTGCCTGCTGAGG - Exonic
908355791 1:63323877-63323899 CCCCTACGGCCTGCACCCTGCGG + Exonic
912572341 1:110633752-110633774 CCCTGACATCCAGAATCCTGGGG - Intergenic
912922208 1:113880137-113880159 CCAGCACTTCCTGCATCCTGTGG + Intronic
915360571 1:155284206-155284228 CTCCCACCTCCTGCTCCCTGTGG - Intronic
915399248 1:155610478-155610500 CCCCGACGTCCTGTATCGTACGG + Exonic
915416363 1:155746058-155746080 CCCCGACGTCCTGTATCGTACGG + Intergenic
915902888 1:159858808-159858830 CCCCTACGTCCTGGACCCTGAGG - Exonic
916212142 1:162367779-162367801 CCCCTACCTGCTGCATCGTCAGG + Exonic
920166167 1:204037514-204037536 CGCTGGCCTCCTGCATGCTGTGG - Intergenic
922808737 1:228404163-228404185 CCCTGGCCTCCTCCTTCCTGTGG + Intronic
923461693 1:234214447-234214469 CGCCGATCGCCTACATCCTGGGG - Intronic
1064282941 10:13967959-13967981 CCCCGACCTCCTGGGCTCTGGGG - Intronic
1066688471 10:38003339-38003361 CCCAAATCTCCTGCATCCTGTGG + Intergenic
1067655175 10:48186406-48186428 CCCAGAATTCCTGCATGCTGTGG + Intronic
1069771791 10:70905157-70905179 GCACGGCCTCCTGCAGCCTGGGG + Intergenic
1070747563 10:78943764-78943786 CACCAACCTCCTCCATCCTTGGG - Intergenic
1076379201 10:130013879-130013901 CACTAACCTCCTGCATCCTCCGG - Intergenic
1076800721 10:132826824-132826846 CCCCAAAATCCTGCAGCCTGGGG - Intronic
1078522206 11:12072628-12072650 CCCTGACTTCTTCCATCCTGTGG + Intergenic
1079008783 11:16811548-16811570 GCCCATCCTCCTGCAGCCTGTGG - Intronic
1082854623 11:57795606-57795628 GCCCCGGCTCCTGCATCCTGGGG - Exonic
1082946866 11:58770669-58770691 CCCAGATCTCCCACATCCTGGGG - Intergenic
1083228648 11:61300820-61300842 CCACCACCTCCTGCATCTTGGGG + Exonic
1083695162 11:64437772-64437794 CCCCTTCCTCCTGCCTCCCGAGG + Intergenic
1084024385 11:66438703-66438725 CGCCGACCTCGGGCTTCCTGAGG + Exonic
1084057585 11:66646318-66646340 TCCCTGCCTCCTGCCTCCTGCGG + Exonic
1084973920 11:72786055-72786077 GCCCGGCCTGCTGCACCCTGAGG - Intronic
1085395090 11:76203174-76203196 CCCAGGCCTCCTGCATCCTGAGG + Intronic
1085396150 11:76208142-76208164 CCCCGTCTCCCTGCAGCCTGCGG + Intronic
1086502176 11:87464684-87464706 CCCCGACCACCTGCACACTGAGG - Intergenic
1089590261 11:119535573-119535595 CCCCGACCACCTGCATCCCCTGG - Intergenic
1089690768 11:120185454-120185476 CTCCCACCACCTGCCTCCTGCGG - Intronic
1090485825 11:127111010-127111032 CCCTGACCTCTTTCCTCCTGAGG - Intergenic
1091814467 12:3426036-3426058 TCCCGAAATCCTGCACCCTGCGG - Intronic
1091852143 12:3708252-3708274 CCCGGTCCTCCTGCCTCCAGAGG + Intronic
1091930646 12:4392639-4392661 CCCTGACCTCCAGCAGGCTGAGG - Intergenic
1096328290 12:50685827-50685849 TGCTGACCTCCAGCATCCTGTGG - Exonic
1096617140 12:52839771-52839793 CCTCGCCCTCCAGCAGCCTGCGG + Exonic
1102199028 12:111044737-111044759 CCCCTACCTCATCCCTCCTGTGG - Intronic
1102205652 12:111089117-111089139 TCCCTAGCTCCAGCATCCTGTGG + Intronic
1102525546 12:113510098-113510120 ACCCTGCCTCCTCCATCCTGGGG + Intergenic
1104050215 12:125189677-125189699 CCCCAACTCCCTGCATCCGGTGG - Intronic
1105353084 13:19633536-19633558 CCCCGCCCACCTGCGTCCCGCGG + Intergenic
1105423435 13:20273008-20273030 CCGGGACCTCCCGCATCCAGCGG + Intergenic
1113268511 13:108645928-108645950 CCCCACCTTCCTGCACCCTGGGG - Intronic
1113593954 13:111518317-111518339 CCCCGGCTTCCTGCTCCCTGTGG + Intergenic
1117294906 14:54370491-54370513 CCCCCACCTCCTTCCTACTGTGG + Intergenic
1119420740 14:74506438-74506460 TCCAAACCTCCTGCCTCCTGAGG + Intronic
1120398710 14:84001263-84001285 CCCTGCCCTCCTGCATTCTAGGG - Intergenic
1121105881 14:91279423-91279445 CCCAGAGCTCCTCCTTCCTGAGG - Intronic
1121489448 14:94347508-94347530 CCCCTGCCCCCTGCATGCTGTGG - Intergenic
1122884860 14:104706417-104706439 CCCCGTCCTTCTGGGTCCTGTGG - Intronic
1126064979 15:44819683-44819705 CCCAGAGCTCCTGGATCCAGCGG + Intergenic
1128517055 15:68348972-68348994 CCCACAGCTCCTGCTTCCTGGGG + Intronic
1128543293 15:68551488-68551510 CCCCGGCCTCCTCTTTCCTGAGG + Intergenic
1131090970 15:89624829-89624851 CCCCCATCTCCTCCTTCCTGTGG + Exonic
1132756836 16:1489509-1489531 CCTCAGCCTCCTGCCTCCTGAGG + Intergenic
1132761196 16:1509357-1509379 CCAAGGCCTCCTGCAGCCTGGGG - Intronic
1132932155 16:2464311-2464333 CCCCATCCTCCTGGGTCCTGGGG - Intronic
1134190072 16:12114228-12114250 CCCCTAACTCCAGCATCCAGAGG + Intronic
1136343347 16:29659632-29659654 ACCCTACCTCCTGCCTCCAGAGG - Intergenic
1136412775 16:30086546-30086568 GGCCTACCTCCTGCACCCTGCGG - Exonic
1136500262 16:30666558-30666580 CCCCAGCCTCATGCAGCCTGAGG - Intronic
1136517099 16:30774834-30774856 CCCCCACCTCATGCATCCCAAGG + Exonic
1136933221 16:34436826-34436848 CCCCGTTCTCCTCCTTCCTGCGG + Intergenic
1136971351 16:34974988-34975010 CCCCGTTCTCCTCCTTCCTGCGG - Intergenic
1137573030 16:49579056-49579078 CTCCCACCCTCTGCATCCTGGGG - Intronic
1137598309 16:49739362-49739384 CCTTGTCCTCCTGCATCCTCAGG - Intronic
1139356045 16:66367499-66367521 CCCAGACCTCCTGCTTCTGGGGG - Intronic
1139364498 16:66425669-66425691 CCCCGCCCTCCTGCAGGCTGGGG - Intergenic
1140347419 16:74227710-74227732 CCCCCAGCCCCTGCCTCCTGGGG - Intergenic
1140447192 16:75039690-75039712 CCCAGACCTACTGAATCCAGTGG + Intronic
1141055284 16:80808060-80808082 TCTTGACCTCCTGTATCCTGTGG + Intergenic
1141303133 16:82836698-82836720 TGCCGACTTCCTGCATTCTGTGG + Intronic
1141388554 16:83645592-83645614 CCCCAACCTCCCGCACCCTCAGG + Intronic
1141431676 16:83973414-83973436 CCCTGGCCTCCTGCATCCCTGGG + Intronic
1141625305 16:85258490-85258512 CTCAGCCCTCTTGCATCCTGCGG + Intergenic
1142285162 16:89168672-89168694 CCCCGGCCTCCTCCAGCCTCAGG + Intergenic
1142549788 17:731962-731984 CCCGGACCTCACGCTTCCTGAGG + Intergenic
1142579895 17:935366-935388 CCCCCACCTCCTATATCATGTGG + Intronic
1143111758 17:4556765-4556787 CGCTCACCTCCTGCCTCCTGGGG - Intergenic
1143250111 17:5517286-5517308 CACCTACCTCCTACCTCCTGTGG + Intronic
1144072606 17:11688338-11688360 CCACTCCCTTCTGCATCCTGGGG - Intronic
1144621172 17:16819418-16819440 CCCAGACCACCTGCCTTCTGGGG - Intergenic
1145025702 17:19466386-19466408 CCCCAACCTCCTCCATCCCCCGG - Intergenic
1145799926 17:27676446-27676468 CCCCCATCTGCTGCTTCCTGGGG + Intergenic
1145867549 17:28250584-28250606 CCCCGACCACCAACCTCCTGGGG - Intergenic
1146161071 17:30559754-30559776 CCCAGAGGCCCTGCATCCTGGGG + Intronic
1146647677 17:34585911-34585933 CCCAGATATCCTGTATCCTGAGG - Intronic
1147134969 17:38429094-38429116 CGCCGCCCTCCTGGATCCTGGGG + Intronic
1147156419 17:38546536-38546558 GGCCGACCCTCTGCATCCTGCGG - Intronic
1147573152 17:41583711-41583733 CCCAGACCACCTGCCTTCTGGGG - Intronic
1147699991 17:42387958-42387980 CCCCGATTTCCTGCTCCCTGGGG - Intronic
1148690648 17:49524997-49525019 CACCAGCCTCCTGCAGCCTGGGG - Intergenic
1149848445 17:60021144-60021166 CTCCCATCTCCTGCTTCCTGGGG + Intergenic
1149861724 17:60125380-60125402 CTCCCATCTCCTGCTTCCTGGGG - Intergenic
1150626660 17:66845938-66845960 ACCTGACCTCCTGCCTCTTGGGG + Intronic
1151438888 17:74115485-74115507 CCCCTCACTCCTGCTTCCTGGGG - Intergenic
1151787105 17:76280358-76280380 CCACCAGCTCCTGCATCATGTGG + Exonic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1152095631 17:78270054-78270076 CCCTGAGCCCCTGCAGCCTGGGG - Intergenic
1157717058 18:49895030-49895052 CCACCTCCTCCTGCAGCCTGAGG + Exonic
1159596095 18:70384158-70384180 CGCCTACCTCCTGCATGATGTGG + Intergenic
1159914042 18:74173196-74173218 CCACCACGTCCTGCATGCTGAGG + Intergenic
1160099170 18:75904403-75904425 CCCCTTCCACCTGCCTCCTGTGG - Intergenic
1160195954 18:76755667-76755689 CCCGGAAAGCCTGCATCCTGCGG + Intergenic
1160719437 19:590809-590831 CCCCGACATCCTCCGCCCTGCGG + Intronic
1160930637 19:1568144-1568166 CGCCGGCCGCCTGCATCCAGCGG + Intergenic
1161348036 19:3777699-3777721 CCCCAAGCCCCTGCCTCCTGTGG - Intergenic
1161418888 19:4164523-4164545 CTCCTACCTCCTGCGACCTGGGG + Exonic
1162128658 19:8512427-8512449 CCACCAGCTCCTGCATGCTGGGG + Exonic
1162464109 19:10830403-10830425 CCCCAACTGCCTGCACCCTGGGG + Intronic
1163628013 19:18402045-18402067 CCCCCACCACCTGCAGCCTCGGG - Intergenic
1165068556 19:33242208-33242230 CCCTTCCCTCCTCCATCCTGAGG - Intergenic
1166398567 19:42460968-42460990 CCCAGTCCTCCTAGATCCTGGGG + Intergenic
1166854713 19:45777810-45777832 CCCCGAGATCCTGCAGGCTGTGG - Exonic
1167409159 19:49334938-49334960 CTCTGTCCTCCTGCCTCCTGGGG - Intergenic
1167658973 19:50784765-50784787 CCTCTACCTCCAGCATCCTCAGG - Intergenic
926364378 2:12119791-12119813 CCCAGACCTGCTGCATTCAGAGG + Intergenic
927153163 2:20207128-20207150 ACAAGACCTCCTGCCTCCTGAGG + Intronic
927391134 2:22596708-22596730 CCCAGCCCTCCTACATCCTAAGG - Intergenic
927591355 2:24360535-24360557 CCCCGCCCCCCGGCTTCCTGCGG - Exonic
928214675 2:29351474-29351496 CTCAGAGTTCCTGCATCCTGGGG + Intronic
928713467 2:34033641-34033663 CTCTCACCTCCTGCAACCTGAGG - Intergenic
929056471 2:37881316-37881338 CCCCCAACTCCTGCAACCTTGGG + Intergenic
929601334 2:43206582-43206604 CCCCACCTTCATGCATCCTGGGG - Intergenic
935070717 2:99691343-99691365 TCCTGAACTCCTGCAGCCTGCGG + Intronic
937071530 2:119067306-119067328 CCCCTACCTCCGTGATCCTGAGG + Intergenic
938178959 2:129162638-129162660 CCACCTCCTCCTGCATCCTGGGG - Intergenic
938727521 2:134120859-134120881 CCCGGGCCTCCTGGATCCTCTGG - Intronic
942459546 2:176159802-176159824 CCGCGACTTCCCGCTTCCTGCGG - Intronic
942549009 2:177094996-177095018 CTCACATCTCCTGCATCCTGGGG + Intergenic
946154078 2:217795873-217795895 GTCCCTCCTCCTGCATCCTGTGG - Intergenic
946978072 2:225175334-225175356 ACTCCACCTCCTGGATCCTGAGG + Intergenic
947550382 2:231041419-231041441 CCCCGACCTCCTGCATCCTGAGG + Intronic
947638550 2:231693229-231693251 CCCTGAGCTCCAGCAGCCTGAGG + Intergenic
948907435 2:240986557-240986579 CTCCCACCTCCAGCGTCCTGGGG + Intronic
1169112834 20:3044620-3044642 CCCCACCCTCCTGGAGCCTGAGG + Intronic
1171018219 20:21561005-21561027 CCCAGACCTACTGCACCCTGAGG - Intergenic
1171411667 20:24952022-24952044 CGGGGACCTCCTGCCTCCTGGGG + Intronic
1172289036 20:33762024-33762046 CCTCGTCCTCCTGCCTGCTGGGG - Exonic
1172992291 20:39045531-39045553 CCACAACCTCCTGCCTCCCGGGG - Intergenic
1173815586 20:45985713-45985735 CCCCTACCTCCTCCTTCCTCTGG - Intergenic
1175133646 20:56807489-56807511 CCGTGACCTCCTGCATCCCCCGG + Intergenic
1175523239 20:59616389-59616411 GCCCTCCCTCCTGCATCTTGAGG - Intronic
1176035897 20:63036313-63036335 CCCCGGCCCCCTCCAGCCTGGGG + Intergenic
1178301551 21:31457791-31457813 CCCCCACCTCCTGCCTCCAGGGG + Intronic
1179384695 21:40931015-40931037 CCCTGCACTCCTGCATCCTGAGG + Intergenic
1179922947 21:44516952-44516974 CCCCTCGCTCCTGCACCCTGGGG + Intronic
1179930838 21:44569901-44569923 CCCCAACCTCCGCCAGCCTGAGG - Intronic
1180098282 21:45571790-45571812 CCCCAACCTCCCGCGCCCTGTGG + Intergenic
1180260165 21:46663029-46663051 CCCTGAGCTCCCGCATCCTCTGG + Intronic
1180762311 22:18219920-18219942 CGCCCGCCTCCTGCGTCCTGGGG - Intergenic
1180773356 22:18404688-18404710 CGCCCGCCTCCTGCGTCCTGGGG + Intergenic
1180804709 22:18654237-18654259 CGCCCGCCTCCTGCGTCCTGGGG + Intergenic
1180806037 22:18715173-18715195 CGCCCGCCTCCTGCGTCCTGGGG - Intergenic
1180843477 22:18969930-18969952 CCCCCACCTCTTCCTTCCTGCGG - Intergenic
1181192452 22:21151621-21151643 CGCCCGCCTCCTGCGTCCTGGGG + Intergenic
1181216987 22:21340954-21340976 CGCCCGCCTCCTGCGTCCTGGGG - Intergenic
1181459535 22:23078045-23078067 CCCAGCCCTCTTGCTTCCTGTGG + Intronic
1181557807 22:23681793-23681815 CCCAGACCTCCTGCCTCCCATGG - Intergenic
1181583786 22:23842109-23842131 CCCCGCCCTGCTGCACACTGTGG - Intergenic
1182103925 22:27675522-27675544 CCCTTACCACCTGCATCGTGTGG + Intergenic
1182526446 22:30923323-30923345 CCCAGACCTCCTTCACCCTTCGG + Intergenic
1183232167 22:36589747-36589769 CTCTGCCCTCCTGCATCTTGGGG + Intronic
1183716498 22:39536189-39536211 CCCGGAGCTCCTGGCTCCTGTGG + Intergenic
1183776065 22:39966554-39966576 CCCCCAACTCCTTCATCCTTGGG - Intronic
1185092350 22:48783010-48783032 AGCCGCCATCCTGCATCCTGAGG - Intronic
1203235186 22_KI270731v1_random:145670-145692 CGCCCGCCTCCTGCGTCCTGGGG + Intergenic
950368116 3:12503679-12503701 CATCGGCCTCCTGCATCCTGGGG + Exonic
952567737 3:34679629-34679651 CCCAGGTCTCCTGCATCGTGGGG - Intergenic
953386619 3:42509938-42509960 GCCCCACCACCTGCAACCTGAGG + Intronic
953417433 3:42730988-42731010 CCCAGCCCTCCTGCATCTTCTGG + Intronic
953439536 3:42906138-42906160 CCCCGGCCTCCCGGATGCTGGGG + Intronic
954301281 3:49702035-49702057 CCCCCATCTCCTGGAGCCTGAGG + Intronic
954408396 3:50358358-50358380 CCCTGAGATCCTGCAGCCTGTGG - Exonic
954682831 3:52355199-52355221 CCCCGCCCTACTGCATTCAGAGG + Intronic
956005661 3:64775822-64775844 CTCCGTCCCCCTGCATCCTCAGG - Intergenic
956742944 3:72289226-72289248 CTCCCACCTCCTGCAAACTGGGG + Intergenic
957402835 3:79738801-79738823 CCCCGGCAGACTGCATCCTGAGG + Intronic
957505524 3:81115843-81115865 CCCCCACCTCCTGCACCTTCTGG - Intergenic
961156504 3:124684247-124684269 CCCCCACCTACACCATCCTGCGG + Intronic
961519177 3:127456888-127456910 CCCCGCCCACCCGCTTCCTGCGG - Intergenic
962200643 3:133398820-133398842 CCTGGACCTCCTTCCTCCTGAGG + Intergenic
967673653 3:192270067-192270089 CCACATCCTCCTGCATTCTGAGG + Intronic
968643582 4:1727447-1727469 CCCCGCCCTCATGCTTCTTGGGG - Intronic
968834372 4:2952268-2952290 ACCCTACCTCCAGCTTCCTGAGG + Exonic
968968349 4:3780878-3780900 CCTCGGCCTCCCACATCCTGGGG - Intergenic
969063269 4:4456522-4456544 CCTGGCCCTCCTGCTTCCTGTGG + Intronic
969119930 4:4900667-4900689 CCACTTCCTCCTGCTTCCTGGGG + Intergenic
969422143 4:7103561-7103583 CCCCGCACTCCTGAATCCTGTGG - Intergenic
971008416 4:22402745-22402767 GGCCAGCCTCCTGCATCCTGTGG - Exonic
973799198 4:54459747-54459769 CCCTGACTTCCTGCAACATGGGG - Intergenic
976431166 4:84965774-84965796 CCCCCCCCCGCTGCATCCTGCGG - Intronic
977607353 4:98996018-98996040 CCGCCCCCTCCTGCCTCCTGGGG + Intronic
978243723 4:106548362-106548384 CCTCTCCCTCCTCCATCCTGAGG - Intergenic
978497691 4:109377745-109377767 TCCCCACCTCCTGCAGGCTGAGG + Intergenic
981026118 4:140078527-140078549 CCCCACCCTCCCCCATCCTGTGG - Intronic
985145267 4:186889492-186889514 CGCCGGCCTCCCGCATGCTGTGG - Intergenic
985491457 5:182109-182131 GCCAGTCCTCCTCCATCCTGGGG + Exonic
985522913 5:387256-387278 CCCCACCCTGCTGCCTCCTGGGG + Intronic
985644566 5:1078866-1078888 CCCCGCCCACCTGGATCCTGCGG - Intronic
986308455 5:6532900-6532922 TCACCACCTTCTGCATCCTGGGG + Intergenic
991967606 5:72108038-72108060 CCCCACCCTTCTGCCTCCTGCGG - Intronic
998426986 5:142037074-142037096 CGCCGACCTCGGGCTTCCTGAGG + Intergenic
998531735 5:142891204-142891226 CCACCACCCCCTGCATCGTGTGG - Intronic
1000284896 5:159818603-159818625 CTCCGGCCTCTTTCATCCTGTGG - Intergenic
1000393519 5:160749378-160749400 CCCCCAGCTCCTTCTTCCTGTGG - Intronic
1001823691 5:174729168-174729190 GCCCTACCACCTGCACCCTGAGG + Exonic
1002580705 5:180208272-180208294 CCCGTATCTCCTGCCTCCTGGGG - Intronic
1003015858 6:2466954-2466976 CCCCGACCACCTCCCTCATGGGG - Intergenic
1006794960 6:36726046-36726068 CCCTGACCTCCTGAATCCTTGGG - Intronic
1006830383 6:36964592-36964614 CCCCTCCCTCCTGAGTCCTGGGG + Exonic
1007387717 6:41530869-41530891 CCCCCAACTCCTGCAGACTGTGG - Intergenic
1015669512 6:135672763-135672785 CCCCGTCTTCCAGCCTCCTGTGG - Intergenic
1017042040 6:150315551-150315573 CTGCCACCTCCTGCACCCTGTGG + Intergenic
1018360813 6:163065687-163065709 CCACGTCTTCCTGAATCCTGAGG - Intronic
1018612694 6:165660893-165660915 GCGCGACCTCCTGCACCCGGAGG + Intronic
1018804804 6:167250175-167250197 GCCAGACCTCGAGCATCCTGGGG - Intergenic
1019162136 6:170075869-170075891 CTCTGACCTCCTGCAGCATGTGG - Intergenic
1019435494 7:1020298-1020320 CACAGTCCTCCTGCAGCCTGGGG + Intronic
1019662934 7:2235298-2235320 CCCAGACATCCTGCAACCTGGGG - Exonic
1019738339 7:2661177-2661199 CTCCGTACTCCTGCATGCTGTGG + Intronic
1022902518 7:34825030-34825052 CCTCCACCTCCTGCCTCCTGAGG + Intronic
1023131848 7:37011344-37011366 TGCCCACCTCCTCCATCCTGGGG + Intronic
1023505981 7:40900036-40900058 CCCCCACCTCCTTCATCCTCGGG + Intergenic
1024249126 7:47492970-47492992 CCCCCAGCTCCTGCTTCTTGGGG + Intronic
1025605785 7:63039012-63039034 CCCCCTCCTGCTGCCTCCTGGGG - Intergenic
1026852848 7:73735722-73735744 CCTCCACCGCCTGCTTCCTGTGG - Intergenic
1027057960 7:75063306-75063328 CATCGAAGTCCTGCATCCTGTGG + Exonic
1032035386 7:128517611-128517633 CCCACACTTCCAGCATCCTGGGG - Intergenic
1034914230 7:155023591-155023613 CCCCAACCGCCTGTATCCTCAGG + Intergenic
1035922881 8:3696985-3697007 CCATGACCTACTGGATCCTGGGG - Intronic
1036646238 8:10612660-10612682 CCCCGTCCTCCGGGGTCCTGGGG + Exonic
1036907903 8:12722954-12722976 CTTCGACCTCCTGAATCATGTGG - Exonic
1038268939 8:26059791-26059813 CCTCGGCCTCCTGAATGCTGTGG - Intergenic
1038547932 8:28440352-28440374 CCTCGGCCTCCTCCATCCTTGGG + Intronic
1039404033 8:37297496-37297518 CCCAGACTTCCTGAGTCCTGGGG - Intergenic
1039510963 8:38091481-38091503 CTCAAATCTCCTGCATCCTGGGG + Intergenic
1040413518 8:47178623-47178645 CCCCACCCTCATTCATCCTGTGG + Intergenic
1043995846 8:86814967-86814989 CTCCTACCACCTGCATCCTCAGG - Intergenic
1045872219 8:106939884-106939906 CCCCTGCCTGCTGCAGCCTGTGG + Intergenic
1050081136 9:1917121-1917143 CCCCAACTTCTTGCAACCTGTGG - Intergenic
1052066346 9:24025871-24025893 ACACTACCTCCTGCATCTTGAGG + Intergenic
1055357444 9:75451880-75451902 CCCCAAGCTCCTGCCTCCTCAGG - Intergenic
1056116836 9:83448912-83448934 CCCAGGCCTCCTTCAGCCTGTGG + Intronic
1056787841 9:89605426-89605448 TCCCGGCACCCTGCATCCTGCGG - Exonic
1057024447 9:91724705-91724727 CCCCGACTTCGTGCACCTTGTGG - Exonic
1057882810 9:98806210-98806232 CACCCCCCTCCTGCAACCTGAGG + Intergenic
1059483701 9:114611510-114611532 CCCCGACCTTCCGCGTCCCGGGG + Exonic
1059656986 9:116366249-116366271 CCCTGACCTCACACATCCTGAGG - Intronic
1062346955 9:136119285-136119307 CCCCGCCCTCCTGGAGCCTGGGG - Intergenic
1062464417 9:136674861-136674883 CCCCAACCACATGCAGCCTGGGG - Intronic
1062543739 9:137052805-137052827 GCCCTGCCTCCTGCATCCTCAGG - Intronic
1062624544 9:137436843-137436865 CCCCGCCCTCAGGCAGCCTGTGG + Intronic
1185504226 X:619748-619770 CCCCATCCTCCTGCCTCCGGGGG - Intergenic
1186399117 X:9240739-9240761 CCCCCACCCCCTGCAGGCTGGGG + Intergenic
1186402148 X:9269841-9269863 CCCCGAGCTTCTGCTTCATGGGG + Intergenic
1189387602 X:40550138-40550160 TCCTGACCTCCTGCTTTCTGAGG - Intergenic
1193717376 X:84948766-84948788 TCCCGAAGTCCAGCATCCTGTGG + Intergenic
1195613477 X:106894765-106894787 CCCTGGCCTCCTGCAGCCTACGG - Intronic
1196002796 X:110804794-110804816 TCCCAACCTCCTGCTCCCTGTGG + Intergenic