ID: 947555082

View in Genome Browser
Species Human (GRCh38)
Location 2:231085128-231085150
Sequence GTCCACCCCATTCCCAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947555082_947555085 11 Left 947555082 2:231085128-231085150 CCTTTCTTGGGAATGGGGTGGAC 0: 1
1: 1
2: 0
3: 15
4: 149
Right 947555085 2:231085162-231085184 CAGATGGACAATAAGTGTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 128
947555082_947555084 -5 Left 947555082 2:231085128-231085150 CCTTTCTTGGGAATGGGGTGGAC 0: 1
1: 1
2: 0
3: 15
4: 149
Right 947555084 2:231085146-231085168 TGGACGGAAAAGCTTGCAGATGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947555082 Original CRISPR GTCCACCCCATTCCCAAGAA AGG (reversed) Intronic
901811400 1:11768702-11768724 GAGCACCCCTTTCCCAAGGAGGG - Intronic
902575131 1:17372783-17372805 AAGCACCCAATTCCCAAGAAGGG - Intronic
907515876 1:54993220-54993242 GCCCACCCCACTTCCATGAAAGG + Intergenic
908688732 1:66752913-66752935 GGCCGCCCCCTCCCCAAGAAAGG - Intronic
913153478 1:116069123-116069145 TTCCACCCCATAGCTAAGAAAGG - Exonic
916954272 1:169815420-169815442 GCCCACCCCTTTCCCAGAAAGGG - Intronic
917028646 1:170666785-170666807 GTGGACGCCACTCCCAAGAAGGG + Intronic
918447258 1:184627912-184627934 CTCCACCTCATTGCCAGGAAGGG + Exonic
923385838 1:233464528-233464550 ATCTACCCCGTTCCCAAGGAAGG + Intergenic
923658887 1:235941592-235941614 GACCAACCCTGTCCCAAGAATGG + Intergenic
1064263052 10:13801399-13801421 GTCCACTCCAATCCCATGAGGGG + Intronic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1067274458 10:44821629-44821651 GTGAAGCCCATTCCCATGAACGG - Intergenic
1071255179 10:83865990-83866012 GTCCTCTCCATGCCAAAGAATGG + Intergenic
1071883664 10:89926917-89926939 CTCCACCCCACACACAAGAAGGG + Intergenic
1072120536 10:92402058-92402080 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1074012360 10:109495445-109495467 GTCCATCCCTTTCCTAACAATGG + Intergenic
1077614423 11:3664840-3664862 GTCCACCCCATTCCCACACACGG - Intergenic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1078664584 11:13313996-13314018 GACCACGCCATTCCCAGGAGAGG - Intronic
1079103035 11:17553223-17553245 CTCCACCCCACCCCCAGGAAGGG + Intronic
1080295811 11:30725980-30726002 GTGCAACTTATTCCCAAGAAAGG + Intergenic
1080641536 11:34161221-34161243 GGCCACTCCATGCCCAGGAAGGG - Intronic
1081695222 11:45104934-45104956 TTCCACCCCATTCCCATCACGGG + Intronic
1082622818 11:55444971-55444993 GTGCACACCATTTCCAATAATGG - Intergenic
1082964130 11:58948150-58948172 CTCCACCCCCTTTCCCAGAAGGG - Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1083894837 11:65614587-65614609 GTTCACCCCCTTCCCAAGTGTGG - Intronic
1085723538 11:78933938-78933960 GTCCCCCCCTTTCCCCAGGAAGG - Intronic
1087673249 11:101129598-101129620 GTACAGCCCATTCCCAGGAAGGG + Exonic
1089737035 11:120556651-120556673 GTTAAGCCCATTCCCAAGACAGG - Intronic
1094461239 12:30698528-30698550 TTCCACTTCATTCCAAAGAATGG + Intergenic
1095708042 12:45258995-45259017 ATCCACCCCTTCCCCAAGAAGGG - Intronic
1096061982 12:48709074-48709096 GTCCCCCCCAACCCCAAGATAGG - Intronic
1096492147 12:52018798-52018820 GTCCTCCCTAGTCCCAGGAAGGG + Intergenic
1096699326 12:53371688-53371710 CACCACCCCATTCCCAGAAAAGG - Intergenic
1097302549 12:58034278-58034300 AACCACCCCATCCCCAACAATGG - Intergenic
1098208460 12:68137166-68137188 GTCCAACTTATTCCCAGGAATGG + Intergenic
1098313811 12:69173490-69173512 GTCCAGGCCTTTCCCAAGATAGG + Intergenic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1105723158 13:23135671-23135693 GGCTACCCCAGTCCCAAGGAAGG + Intergenic
1105787026 13:23759718-23759740 GCCCACCCCTTTCCACAGAATGG - Intronic
1107649216 13:42527435-42527457 GACCTCCCCATTCTCAAGCAGGG - Intergenic
1108179425 13:47826077-47826099 GTCCACCCTTGACCCAAGAAAGG - Intergenic
1111040977 13:82747080-82747102 GCCCACCCAATTACCAAGGATGG - Intergenic
1112062427 13:95754722-95754744 GTCCACCTCATGCTCCAGAAAGG + Intronic
1116497981 14:45586304-45586326 GCCTAGCCCATTCCCAAAAAAGG - Intergenic
1118736707 14:68706113-68706135 GTCCCACCCAGTCCCAGGAAAGG + Intronic
1118885225 14:69860343-69860365 GGGCCCTCCATTCCCAAGAAGGG + Intronic
1121751573 14:96362702-96362724 GTCCAAACAATTCCCAAGGAGGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG + Intergenic
1122350140 14:101084281-101084303 GTCCACCCCAAACCCAGGAACGG + Intergenic
1123463910 15:20499782-20499804 CTCCACTCCATTCCTAAGGAAGG + Intergenic
1123654153 15:22500641-22500663 CTCCACTCCATTCCTAAGGAAGG - Intergenic
1123674186 15:22692103-22692125 GTCCAGCTCATACTCAAGAAGGG - Intergenic
1124230205 15:27938470-27938492 TTCCACCCCACTTCCAAAAATGG + Intronic
1124308060 15:28595837-28595859 CTCCACTCCATTCCTAAGGAAGG - Intergenic
1124326196 15:28765089-28765111 GTCCAGCTCATACTCAAGAAGGG - Intergenic
1133658933 16:7895920-7895942 GCCCACACCCTTCCAAAGAAGGG - Intergenic
1135789170 16:25377614-25377636 GTCCAACCCATCCCCCAAAAAGG + Intergenic
1136419257 16:30122291-30122313 TTCGCCCCCATTCCCAGGAAAGG + Intronic
1136991271 16:35152618-35152640 GTCCACCTCCTTCCCAGGATTGG - Intergenic
1138561831 16:57805587-57805609 ATCCACCCCATCCCCAGGCAGGG + Intronic
1139475033 16:67198942-67198964 GTCCAGCACAGTCCCAAGGAGGG - Intergenic
1139728141 16:68919071-68919093 GTCCACCACCTACCCAAAAAAGG - Exonic
1140685934 16:77434387-77434409 TTGCCCCCCATCCCCAAGAAGGG - Intronic
1142088578 16:88197984-88198006 GTCCAGCCCACACTCAAGAAGGG + Intergenic
1144731198 17:17527412-17527434 GTCCACCCCAGTGCCCAGCAGGG + Intronic
1151314118 17:73311507-73311529 GGCCTCCCCCTTCCCAGGAATGG - Intronic
1152380353 17:79939181-79939203 GCCCACCCCATTCCCACCACAGG + Exonic
1155655408 18:28186114-28186136 GTTCACTCCATTCCCACTAACGG + Intergenic
1156337857 18:36186510-36186532 TTCCACCCCATTCCCAGCAGCGG + Intergenic
1157514649 18:48302194-48302216 TTCCTCCCCATTCCCCAGAAAGG + Intronic
1165444290 19:35848463-35848485 GTCCATCCCAGTCCCCAGCAGGG + Intronic
1167235047 19:48309186-48309208 GTCCAGCCCAGTGCCATGAATGG + Intronic
1167869398 19:52355278-52355300 GTCCACCCCATTTCCTGTAATGG + Intronic
925202690 2:1981676-1981698 GTCCTCCCCATGCTCAAGAAAGG - Intronic
925375458 2:3380637-3380659 TCCCACCCCAATCCCAAGACGGG - Intronic
929651981 2:43689160-43689182 ATCCTCCACATTCCAAAGAAAGG - Intronic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
932826190 2:74942420-74942442 TTCCATCCCTTTCCCATGAAGGG - Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
938101126 2:128498905-128498927 GCCCACCCCACTCCCAGAAAGGG + Intergenic
940054653 2:149500765-149500787 GTTTACCCCATTGCCAGGAAGGG + Intergenic
941209720 2:162622570-162622592 TTTCACCCCATCCCCAATAAAGG - Intronic
941466467 2:165833375-165833397 GTCCAAGCCATTCCTGAGAAGGG - Intergenic
941865050 2:170325769-170325791 GTCCAGCCCAGTCCCAAGACTGG + Intronic
942959021 2:181807391-181807413 TTCCATCCCATTCTAAAGAATGG - Intergenic
947024744 2:225724495-225724517 GTAAACCCCAGTCCCAAGACAGG - Intergenic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
949076159 2:242059393-242059415 GTCGACCCCATTCCCATCATGGG - Intergenic
1172122695 20:32608120-32608142 ACCCACCCCATTCCCCACAATGG + Intronic
1174845271 20:53937282-53937304 GTTCACCCCATTCTAAAGTAAGG - Intronic
1175228919 20:57461247-57461269 ACCCACCCCATTGTCAAGAAGGG - Intergenic
1176364648 21:6025535-6025557 GCCCTCCCAAATCCCAAGAAAGG - Intergenic
1179758870 21:43513010-43513032 GCCCTCCCAAATCCCAAGAAAGG + Intergenic
1180843159 22:18968559-18968581 GCCCATCCCATGCCCCAGAATGG + Intergenic
1181058313 22:20270175-20270197 GCCCATCCCATGCCCCAGAATGG - Intronic
1181514853 22:23404628-23404650 GCCCATCCCATGCCCCAGAATGG - Intergenic
1183929391 22:41227405-41227427 CTCCACCTCATGCCAAAGAACGG - Intronic
1184660874 22:45964975-45964997 CTCCACCTCATTGCCCAGAAGGG + Intronic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
951046582 3:18046332-18046354 GTCCAGCCCAAGCACAAGAAAGG - Intronic
951063141 3:18233988-18234010 GACCACAGTATTCCCAAGAATGG + Intronic
952885226 3:38007825-38007847 GTCCACCTCATGTCTAAGAACGG - Exonic
953465181 3:43113671-43113693 GGCCACCCCATTTACAAGAGAGG + Intergenic
953595768 3:44311735-44311757 GAACAGGCCATTCCCAAGAAAGG + Intronic
955344108 3:58148432-58148454 GTGCTACCCATTCCCAAGAAAGG - Intronic
956891350 3:73617178-73617200 AGCCACCCCATCCCCAGGAAGGG - Intronic
961532876 3:127550465-127550487 GACCACCCCATGCCCCAGACAGG - Intergenic
962532983 3:136300958-136300980 TCCCACCCCATTCCCACAAAAGG + Intronic
966240869 3:177754141-177754163 TTCCCCACCATTTCCAAGAATGG - Intergenic
967852054 3:194089723-194089745 GTTAAGCCCATTGCCAAGAAAGG + Intergenic
969343797 4:6558786-6558808 GTCCACTCCAGACCCAGGAAAGG + Intronic
969713891 4:8859389-8859411 TTCCACCCCAATCCCAGAAAAGG + Intronic
971091545 4:23351728-23351750 TTGAGCCCCATTCCCAAGAAAGG + Intergenic
974289031 4:59907056-59907078 GTACAACCCATTCTTAAGAAGGG + Intergenic
975329834 4:73100269-73100291 GACCACCCCAGTCCCAAGGAAGG + Intronic
977937255 4:102821161-102821183 GACCACAACATTTCCAAGAATGG + Intronic
980064959 4:128176886-128176908 GTGCTTCACATTCCCAAGAAAGG + Exonic
981261960 4:142731129-142731151 CCCCACCCCATTCCCCTGAAAGG + Intronic
982859182 4:160427627-160427649 ATCCACTAGATTCCCAAGAAGGG - Intergenic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
1001286332 5:170426780-170426802 TTCCACCCAACTCCCAAGAGGGG + Intronic
1002711495 5:181197844-181197866 ATACACCCCATTCCCAGGAGAGG + Intronic
1003926470 6:10882146-10882168 CTCCACCACAGTCCCAGGAACGG + Intronic
1003954465 6:11148899-11148921 TTCAACCCCAATCACAAGAAAGG - Intergenic
1004020890 6:11774837-11774859 GTCCACCCCATTTCCATCCAGGG - Intronic
1004667369 6:17760956-17760978 GTCCACACCCATCACAAGAAAGG + Intronic
1007691177 6:43702598-43702620 CTCCACCGCTTTCCCAAGAGTGG + Intergenic
1007749532 6:44063394-44063416 CTGCATCCCATTCCCAAGGAGGG + Intergenic
1008467173 6:51843635-51843657 GTCATACCCATTCCCAAGCACGG + Intronic
1015004951 6:128268492-128268514 AAGGACCCCATTCCCAAGAAAGG - Intronic
1017207424 6:151818467-151818489 GTCCAACCCTTTTCTAAGAAGGG + Intronic
1018717227 6:166542910-166542932 GTTCACCTCATTTCCAAAAAAGG + Intronic
1019048382 6:169165163-169165185 GTCCACCCCATCACCATGGACGG - Intergenic
1020441318 7:8220170-8220192 CTCCACACATTTCCCAAGAAAGG - Intronic
1023217928 7:37885369-37885391 GTCCACTCCGTCCCCAGGAAAGG - Intronic
1023463480 7:40427003-40427025 CTCCACCCTATTGCCCAGAATGG + Intronic
1023744372 7:43309168-43309190 CTCCTTCCCATTCCCAAGAGTGG - Intronic
1027513685 7:79114664-79114686 AGCCCCCCCATTACCAAGAAAGG + Intronic
1027756994 7:82226449-82226471 GTCCTCCCCTTTCTCTAGAAGGG - Intronic
1034338938 7:150340366-150340388 GACCAGCGCATTCCCACGAAGGG - Intronic
1037538193 8:19847145-19847167 GTGGACTCCATTCTCAAGAATGG + Intronic
1037754652 8:21703061-21703083 GACCACCCCCTTCCCTGGAATGG + Intronic
1038198081 8:25386243-25386265 GTCCACCTCATCCCCAACCACGG - Intronic
1038401616 8:27288337-27288359 AACCACCCCATTCCCAAATAAGG - Intronic
1041095170 8:54342586-54342608 GTCCCCCACACTCCCAAGAAGGG - Intergenic
1042872568 8:73411844-73411866 GTCCACCCCATCCCCATGGCTGG + Intergenic
1042947315 8:74168191-74168213 ATCAACCCCATTCCACAGAATGG - Intergenic
1043250790 8:78070722-78070744 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1047411281 8:124626684-124626706 AACCACCCCATTCCCATGACCGG - Intronic
1053428390 9:38026044-38026066 CCCCACCCCCTTCCCAAGGAAGG + Intronic
1055901179 9:81239813-81239835 ATCCTTCACATTCCCAAGAAAGG - Intergenic
1058326381 9:103703611-103703633 GTCCAGGCCAGTGCCAAGAAGGG - Intergenic
1058552505 9:106129978-106130000 GACTACCCCATACTCAAGAAGGG - Intergenic
1059468729 9:114487491-114487513 CTCCATCCCATTCCCTGGAAGGG + Intronic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1189240912 X:39523559-39523581 GTCCACCTCTATCCCAAGAGGGG - Intergenic
1190876912 X:54466489-54466511 GTCCACACCATTTGCCAGAACGG - Intronic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1195573207 X:106420046-106420068 GACCACCCTCTTCCCAGGAAAGG + Intergenic
1199812306 X:151362045-151362067 GACCACCCCATTCCCCAGAGAGG + Intergenic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic