ID: 947559779

View in Genome Browser
Species Human (GRCh38)
Location 2:231138793-231138815
Sequence TGTGCGCTACGGAGCTGCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947559774_947559779 19 Left 947559774 2:231138751-231138773 CCCAAGTGTTGTCTCTTTGTTGT 0: 1
1: 0
2: 2
3: 36
4: 376
Right 947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG 0: 1
1: 0
2: 0
3: 2
4: 44
947559773_947559779 30 Left 947559773 2:231138740-231138762 CCTGAACAGTGCCCAAGTGTTGT 0: 1
1: 0
2: 0
3: 3
4: 117
Right 947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG 0: 1
1: 0
2: 0
3: 2
4: 44
947559775_947559779 18 Left 947559775 2:231138752-231138774 CCAAGTGTTGTCTCTTTGTTGTC 0: 1
1: 0
2: 1
3: 24
4: 237
Right 947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947559779 Original CRISPR TGTGCGCTACGGAGCTGCAA TGG Exonic
903743797 1:25573514-25573536 TGTGCCCTCCTGAGCCGCAAGGG - Intergenic
905722850 1:40221547-40221569 AGTGCGCTACGCAGTTACAAGGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
910906043 1:92179851-92179873 TGTGCTCTACATAGCTGAAAAGG - Intronic
915348807 1:155212081-155212103 TGGACACTAGGGAGCTGCAAGGG - Intronic
915351999 1:155232707-155232729 TGGACGCTGGGGAGCTGCAAGGG - Intergenic
920766854 1:208841811-208841833 GGTGCTCTGCGGAGCTGCACAGG + Intergenic
1076821172 10:132940476-132940498 TGTCCGCTAGGGAGCAGCAAAGG + Intronic
1083384438 11:62297092-62297114 TGGGCCCTGAGGAGCTGCAAGGG + Intronic
1084003631 11:66312277-66312299 TGTGCGCTACGCCGCAGCCAGGG + Intergenic
1084054813 11:66625408-66625430 AGTGCGGTAAGGAGCTGCCAGGG - Exonic
1085343030 11:75745937-75745959 TGTGTGCTGGGGACCTGCAAAGG - Intergenic
1104352921 12:128060199-128060221 TCTGAGCTACGCAGCTGCATGGG + Intergenic
1104949501 12:132432848-132432870 GGAGGGCTACGGAGCTGCCAGGG - Intergenic
1111407587 13:87829400-87829422 TGTCAGCTACAGAGCTGGAATGG + Intergenic
1121610028 14:95272263-95272285 TGTGGGCTGAGGAGCTGGAAGGG + Intronic
1122723504 14:103735537-103735559 TGTGCCCTGCAGAGCTGCCAGGG - Intronic
1129098650 15:73236866-73236888 TGTGGGCTGCGGAGCTCCAGGGG + Intronic
1131320387 15:91384299-91384321 TGTGCACTCTGGATCTGCAACGG + Intergenic
1134194447 16:12148357-12148379 TGTGAGCTAAGGAGCTGTTAGGG + Intronic
1139638178 16:68271687-68271709 TGTGCTCTTGGGAGCTGCTAGGG + Intronic
1147718150 17:42521824-42521846 TGTGCACTGCGGAGCAGCCAAGG - Exonic
1153272836 18:3340520-3340542 TGTGAGGTAAGGATCTGCAAAGG - Intergenic
1164541411 19:29124182-29124204 TGTGCCCTACAAAGCTACAAAGG - Intergenic
947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG + Exonic
1176863155 21:14025306-14025328 TGTGGTCTACGGAGGTGCATAGG + Intergenic
1183953659 22:41366925-41366947 TGTGCGCTTCTGAGCCTCAAGGG - Intergenic
950536270 3:13580803-13580825 TGTGCGCTACGGAGGAGCTGTGG - Intronic
954751489 3:52816711-52816733 AGTGCCCTCCGGAGCTGCAGGGG + Intronic
959513226 3:107237152-107237174 TGTGCTCTAAGGAACAGCAAGGG - Intergenic
960375306 3:116893206-116893228 AGTGCCCAACGGAGCTGTAAGGG - Intronic
979107474 4:116705842-116705864 TGGGCGCTTTGGAGCTGCAGAGG + Intergenic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
993532696 5:89043764-89043786 TGTGGTCTACTGAGCTGAAATGG - Intergenic
1005356981 6:24994522-24994544 AGTGGGCTAGGGAGCAGCAATGG - Intronic
1015753640 6:136586402-136586424 TGTGTGCTACTGTCCTGCAAAGG + Intronic
1021921166 7:25486427-25486449 TGGGAGCTCTGGAGCTGCAATGG - Intergenic
1024059896 7:45689977-45689999 TGTGGGCAGTGGAGCTGCAAAGG + Intronic
1024100777 7:46030601-46030623 TGTGCTCCACAGAGCTGCAAGGG - Intergenic
1029643881 7:101839228-101839250 TGTGAGCTAGGGTGCTGCTACGG - Intronic
1031833875 7:126658693-126658715 TGTGCTCTAAGGAACTGGAATGG + Intronic
1049182998 8:141232582-141232604 TGAGCGCTCATGAGCTGCAATGG + Intronic
1049183024 8:141232801-141232823 TGAGCGCTCGCGAGCTGCAACGG + Intronic
1050853214 9:10315711-10315733 TGTGCCCTGCGGAACTGTAAAGG - Intronic
1052989463 9:34510731-34510753 GAGGCGCTAGGGAGCTGCAAAGG - Intronic
1188529469 X:31123505-31123527 TGAGCTCTAAGGAGCAGCAAAGG - Intronic
1197780627 X:130156102-130156124 ATTGTGCTAAGGAGCTGCAATGG + Intronic