ID: 947561592

View in Genome Browser
Species Human (GRCh38)
Location 2:231158659-231158681
Sequence ACATAGTAACTAACCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947561592_947561595 7 Left 947561592 2:231158659-231158681 CCATCCCAGGTTAGTTACTATGT 0: 1
1: 0
2: 0
3: 10
4: 142
Right 947561595 2:231158689-231158711 AAATGTTCCCACTAGCACCCAGG 0: 1
1: 0
2: 0
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947561592 Original CRISPR ACATAGTAACTAACCTGGGA TGG (reversed) Intronic
900261861 1:1735190-1735212 ACATAAAAACTAACCAGGCATGG + Intronic
901358117 1:8670232-8670254 AACTAGTAACTAACCAGGGAGGG + Intronic
905812958 1:40926405-40926427 ACAAACAAACAAACCTGGGAGGG - Intergenic
908953881 1:69597287-69597309 ACATTCTAGCTAACCTTGGATGG + Intronic
911028203 1:93457347-93457369 ACATTGCAACTAACCACGGAAGG - Intronic
917785398 1:178450811-178450833 ACCTAGTACCTAACCTCTGAAGG + Intronic
922145595 1:222940646-222940668 ATACATTAACCAACCTGGGATGG + Intronic
923247333 1:232145213-232145235 ACATAGAAAATAAGTTGGGAAGG + Intergenic
923991897 1:239447347-239447369 ACATAGAAACTAACTTGTAAAGG - Intronic
1064595968 10:16945610-16945632 ATATAAAAACTAGCCTGGGATGG + Intronic
1068019331 10:51561515-51561537 ACATAGAAACAAACATGGAAGGG - Intronic
1068686957 10:59880485-59880507 ACATAGTGGCTACCCTTGGAGGG + Intronic
1070224951 10:74494251-74494273 ACATAATATCTAACCTGGATAGG - Intronic
1073051048 10:100667709-100667731 ACATAGAAACTAACTGGGCAGGG + Intergenic
1074987409 10:118670332-118670354 ACACAGCAACAAACCTGGCATGG + Intergenic
1076584471 10:131535993-131536015 ACATTTTAACTTACTTGGGATGG - Intergenic
1078744591 11:14099505-14099527 ACATATTAAATTCCCTGGGAAGG - Intronic
1078768600 11:14325076-14325098 ATATAGTACCTCACCTGGAATGG + Intronic
1079372306 11:19861995-19862017 ACAAAGAAAGCAACCTGGGAGGG - Intronic
1084375640 11:68775274-68775296 CCATTGTTACTTACCTGGGATGG - Intronic
1088705000 11:112454113-112454135 ACATAAAAACTAACCTGGCATGG + Intergenic
1091017839 11:132069154-132069176 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017842 11:132069206-132069228 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017847 11:132069310-132069332 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017850 11:132069362-132069384 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017856 11:132069466-132069488 ACATGTTAACTAACCTGTGACGG - Intronic
1091017859 11:132069518-132069540 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017864 11:132069570-132069592 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017867 11:132069622-132069644 ACCTGTTAACTAACCTGTGACGG - Intronic
1091017872 11:132069674-132069696 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017876 11:132069726-132069748 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017887 11:132069928-132069950 ACATGTTAACTAACCTGTGATGG - Intronic
1091017892 11:132070036-132070058 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017896 11:132070109-132070131 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017899 11:132070161-132070183 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017902 11:132070213-132070235 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017905 11:132070262-132070284 ACACGTTAACTAACCTGTGATGG - Intronic
1091017910 11:132070363-132070385 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017913 11:132070419-132070441 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017917 11:132070492-132070514 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017929 11:132070697-132070719 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017932 11:132070749-132070771 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017937 11:132070801-132070823 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017940 11:132070853-132070875 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017943 11:132070905-132070927 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017946 11:132070957-132070979 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017953 11:132071061-132071083 ACGTGTTAACTAACCTGTGACGG - Intronic
1091017958 11:132071165-132071187 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017961 11:132071217-132071239 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017964 11:132071269-132071291 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017967 11:132071321-132071343 ACGTGTTAACTAACCTGTGATGG - Intronic
1091017970 11:132071373-132071395 ACGTGTTAACTAACCTGTGATGG - Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1095223327 12:39646042-39646064 ACATAGTAACTAATCTAGTCTGG + Intronic
1095394962 12:41751565-41751587 ACTTAGTAATTAACCCAGGAGGG - Intergenic
1101732834 12:107440695-107440717 ACATGGTAATTATTCTGGGATGG + Intronic
1101998657 12:109543035-109543057 ACATGGTATCTAGCCTGGGCAGG - Intergenic
1103323354 12:120104199-120104221 ACATAGGAAATAACACGGGATGG + Intronic
1106607885 13:31248517-31248539 GCATGGAATCTAACCTGGGAGGG + Intronic
1106952437 13:34899511-34899533 ACAGAGTCAATAACCTGGAAAGG - Intergenic
1111605568 13:90534403-90534425 CCATAGTAACTACAATGGGAGGG - Intergenic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1122228842 14:100295046-100295068 ACTGAGTATCCAACCTGGGAAGG - Intronic
1126969098 15:54089584-54089606 AAATAGAAAATAACATGGGAAGG - Intronic
1140840613 16:78835255-78835277 AAATAGTAAATAATCTCGGAAGG - Intronic
1144139553 17:12335837-12335859 ACTTATTAACTAAACAGGGAGGG - Intergenic
1146226666 17:31072799-31072821 ACATAGCAGCTAACCTGGACTGG + Intergenic
1148646481 17:49222388-49222410 AAATATTAACTAAGCTGGGGAGG + Intronic
1157153172 18:45239731-45239753 AATTAGTAACGAACATGGGAAGG + Intronic
1158122687 18:54067224-54067246 AAATAATAACTAACTTGGGGGGG - Intergenic
1162927998 19:13939883-13939905 TAATAATAACTAACCTGGTATGG + Intronic
1164861033 19:31562394-31562416 ACATAGTAGCTACCCAGGGATGG + Intergenic
1166510421 19:43405086-43405108 ACATACTAACTAACCTTGCAGGG - Intronic
926308826 2:11659840-11659862 ACATTGTATCTGACCTGGTAAGG - Intronic
926589559 2:14725484-14725506 ACATAATAACTTAAATGGGAAGG + Intergenic
936152806 2:110030904-110030926 TCATACTCACTAACCTGAGAAGG + Intergenic
936191874 2:110340508-110340530 TCATACTCACTAACCTGAGAAGG - Intergenic
938159620 2:128973601-128973623 CAATAGTAAATTACCTGGGAAGG + Intergenic
939011316 2:136849347-136849369 ACTTACTAAATAACTTGGGAAGG + Intronic
942214978 2:173709877-173709899 ACATAGTAGCTAAGGTGGAATGG - Intergenic
945531119 2:210953783-210953805 ACATAGTAATTAACTTGTGGTGG + Intergenic
947286886 2:228527019-228527041 TCATAGTAACAAGCCTGGGTAGG - Intergenic
947561592 2:231158659-231158681 ACATAGTAACTAACCTGGGATGG - Intronic
1169406463 20:5325301-5325323 TGATATTAACTAGCCTGGGAAGG - Intergenic
1173575144 20:44108251-44108273 ACATAGGAAGGAATCTGGGAGGG - Intergenic
1175645968 20:60671935-60671957 ACATAGTAAGTACATTGGGAAGG + Intergenic
1176426265 21:6550201-6550223 AGACAGTAACTAAGCTGGGTTGG + Intergenic
1177952926 21:27561062-27561084 GCAAATTAATTAACCTGGGAAGG + Intergenic
1178423116 21:32457716-32457738 ACCTAGTAAGTAACTTCGGAGGG + Exonic
1179701756 21:43158518-43158540 AGACAGTAACTAAGCTGGGTTGG + Intergenic
1182432560 22:30308860-30308882 AAATAGTAATTAATCTGTGAGGG - Intronic
949284731 3:2388687-2388709 ATATAGAAATTAGCCTGGGATGG + Intronic
952662585 3:35869568-35869590 ACATGGTAACTAATGTGGCAGGG + Intergenic
954616290 3:51970266-51970288 ACAGAGAAACTGACCTAGGAGGG - Intronic
955920260 3:63947715-63947737 TGATAGTAACTAACTGGGGAGGG + Intronic
956532053 3:70231602-70231624 AATTGGTAACTAACCAGGGAAGG - Intergenic
957457956 3:80477581-80477603 TCATAGTAACTAACTTGCCAAGG - Intergenic
958020247 3:87985749-87985771 ATATTGTAAATAGCCTGGGATGG - Intergenic
964499923 3:157337967-157337989 ACATAATAACTATTCTGGGGAGG - Intronic
965210795 3:165784984-165785006 ACATAATATATAACCAGGGATGG - Intronic
970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG + Intergenic
971640137 4:29120723-29120745 ACATAGTAAATGACATGAGAAGG - Intergenic
972249755 4:37287383-37287405 ACATACTAAGCAACCTGGGTTGG + Intronic
973854705 4:54999627-54999649 ACATAGTAAATAACCAGTAAAGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980078108 4:128315301-128315323 ATAAAGTAACTAACCTGGTGTGG - Intergenic
986629081 5:9751988-9752010 ACATAGAAAGCAATCTGGGAAGG + Intergenic
986860116 5:11917748-11917770 ACATCCTAAGTAACCTGGTAGGG - Intergenic
989387714 5:40869810-40869832 ACATATTACATAACCTGGGGAGG - Intergenic
991075382 5:62530700-62530722 CCAAAGTTACTAACCTAGGAAGG - Exonic
993281506 5:85930977-85930999 AAATATTAATTCACCTGGGAAGG + Intergenic
998402932 5:141857392-141857414 TCATAGTAACTGTGCTGGGATGG + Exonic
1005344384 6:24875057-24875079 AACGAATAACTAACCTGGGAGGG - Intronic
1005765712 6:29009827-29009849 AGATAGTAGTTAACCTGGGAAGG - Intergenic
1006675173 6:35757524-35757546 ACATGGTAAGGAACCCGGGAAGG + Intergenic
1007711307 6:43826023-43826045 ACAAAGTCATTGACCTGGGAAGG + Intergenic
1009859671 6:69311000-69311022 ACTGAGAAACTAACCTGGTAGGG + Intronic
1017079548 6:150654519-150654541 AAGTAGCAACTGACCTGGGATGG - Intronic
1017737099 6:157375321-157375343 AGATACTAACAAACCAGGGAGGG + Intergenic
1017979318 6:159385674-159385696 AAATACTAACTAACCTTGTAAGG + Intergenic
1021401770 7:20217850-20217872 ACACTGTCACTCACCTGGGAAGG - Intergenic
1022889787 7:34684676-34684698 GCATAGTTACTTACCTGTGATGG - Exonic
1024707506 7:51976527-51976549 ACATAAAAATTAACCTGGTATGG + Intergenic
1024964239 7:55007470-55007492 TCATTGAAACAAACCTGGGAGGG - Intergenic
1028463151 7:91118934-91118956 ACGTAGTGACCAGCCTGGGATGG + Intronic
1031690160 7:124778135-124778157 AGATATTAACTAAGCAGGGAGGG + Intronic
1032746395 7:134791044-134791066 AAGTAGTATCTCACCTGGGAAGG - Intronic
1036294668 8:7526339-7526361 ACATAATAACTTACCTGGGGAGG - Intergenic
1036294684 8:7526436-7526458 ACATACGAACTTACCTGGGGAGG - Intergenic
1036327878 8:7794555-7794577 ACATACGAACTTACCTGGGGAGG + Intergenic
1036327894 8:7794652-7794674 ACATAATAACTTACCTGGGGAGG + Intergenic
1036495268 8:9264643-9264665 AGATAGTAACTAAGCTATGAGGG + Intergenic
1037222215 8:16537577-16537599 ATATAGTAATAAACTTGGGATGG + Intronic
1041854845 8:62439573-62439595 ACATAGAAAGTAACATGAGAGGG - Intronic
1043131129 8:76462660-76462682 ACATTGTACCTAGCTTGGGATGG + Intergenic
1046324241 8:112620006-112620028 ACATAATAAATAACCAGGGATGG + Intronic
1047677294 8:127216783-127216805 AGATAGCAACCAAGCTGGGAGGG + Intergenic
1050919689 9:11186040-11186062 ACATAGTGATTGATCTGGGAAGG - Intergenic
1055924837 9:81499380-81499402 ACATTGTAAATAGCCTTGGATGG - Intergenic
1057851656 9:98571074-98571096 ACATAGCAAACACCCTGGGAGGG + Intronic
1059862265 9:118478032-118478054 ACCTGGTGACTGACCTGGGATGG + Intergenic
1059886049 9:118745809-118745831 AAATAGTGACTAACCCTGGATGG - Intergenic
1060089694 9:120732103-120732125 GCTTAGAAACAAACCTGGGATGG - Intergenic
1060113445 9:120922992-120923014 ATATAAAAACTAACCTGGCATGG - Intronic
1185771576 X:2769035-2769057 ACAAAGTCACAAACCTTGGAGGG - Intronic
1187081237 X:15990256-15990278 CCATAGTAACTGACTTGGAAAGG - Intergenic
1188485447 X:30676574-30676596 CCAATGTAACTGACCTGGGATGG - Intronic
1193446094 X:81604512-81604534 TCATAGTAAATACCCTGTGAAGG - Intergenic
1193830863 X:86288379-86288401 ACATAGGCAGTAACCAGGGAGGG - Intronic
1196646918 X:118127901-118127923 ACATACTGAGTGACCTGGGATGG + Intergenic
1197272774 X:124443775-124443797 ACAGAGTTACCAACCTGGTAAGG + Intronic
1200822717 Y:7604197-7604219 ACATATTAACTAATCTCGAAAGG - Intergenic
1202237586 Y:22729822-22729844 ACATATTAACTAATCTCGAAAGG + Intergenic