ID: 947562213

View in Genome Browser
Species Human (GRCh38)
Location 2:231165760-231165782
Sequence AAGGTACAAGAGGTAGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947562213_947562217 18 Left 947562213 2:231165760-231165782 CCGACCACTACCTCTTGTACCTT 0: 1
1: 0
2: 2
3: 13
4: 199
Right 947562217 2:231165801-231165823 TCAGATGTTACTCAGTTCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947562213 Original CRISPR AAGGTACAAGAGGTAGTGGT CGG (reversed) Intronic
901989620 1:13102283-13102305 AAGGTCCAGCAAGTAGTGGTTGG + Intergenic
901992192 1:13124469-13124491 AAGGTCCAGCAAGTAGTGGTTGG - Intergenic
904032572 1:27542432-27542454 AAGGTACAAGAGGCGAGGGTTGG + Intronic
905516105 1:38563235-38563257 CAGGGGCAAGAGGAAGTGGTGGG - Intergenic
908752675 1:67439616-67439638 GAGGTACATGGGGCAGTGGTAGG - Intergenic
909349476 1:74634020-74634042 AAGGTACAACAGATAGAAGTAGG - Intronic
910239241 1:85068729-85068751 CAGGTACGGGAGGTAGTGGCTGG - Intronic
910719234 1:90267313-90267335 AAGGAACAAGAGGTGATGGTGGG + Intergenic
915930514 1:160057910-160057932 AGGGCCCAAGAGGTAGTGGCGGG + Intronic
915946851 1:160159041-160159063 AATGTACAAGAGGTGGTGTTGGG + Exonic
916214792 1:162385411-162385433 AAGGTAGAAGGGAAAGTGGTGGG - Intronic
916996711 1:170309267-170309289 AGGGTCCAAGAAGTAGTGATTGG + Intergenic
919091378 1:192982078-192982100 AAGGTACAGGAGATACTGGATGG + Intergenic
919144303 1:193613874-193613896 AAGGTGGCAGAGATAGTGGTGGG + Intergenic
922628325 1:227076556-227076578 AAGGAGCAAGAGATAGTGTTGGG - Intronic
923483013 1:234402354-234402376 AAAGTTCAACAGCTAGTGGTGGG - Intronic
923518021 1:234713740-234713762 AAGGGTCAAGAGTTGGTGGTTGG + Intergenic
923663156 1:235976436-235976458 AAAGCCCAAGAGGAAGTGGTAGG - Exonic
924179092 1:241423853-241423875 AAGGTACAAGCGGTGGCGGCAGG + Intergenic
1064388860 10:14923794-14923816 AAGGTACAATGGGCAGTGTTTGG - Intronic
1065885405 10:30072584-30072606 AAAGAAAAAGAAGTAGTGGTTGG + Intronic
1066007079 10:31155342-31155364 AAGGTACAACAGGTACTAGTGGG - Intergenic
1068203871 10:53822289-53822311 GAGGTAGAAGAGGTGGTGTTGGG + Exonic
1068832147 10:61507585-61507607 CAGGCAGAAGAGGTAGTGGGAGG + Intergenic
1069474279 10:68719510-68719532 AAGGTTCTTGAAGTAGTGGTAGG + Intergenic
1070066769 10:73042719-73042741 GAGTCACTAGAGGTAGTGGTGGG + Intronic
1070654294 10:78260766-78260788 AAGGTAAAAGAGGTAGCTTTGGG - Intergenic
1071142846 10:82532217-82532239 AAGAAACAAGAGCTAGTGTTTGG - Intronic
1072845245 10:98822794-98822816 AAGTTAAAAGATGTTGTGGTAGG + Intronic
1073805546 10:107093784-107093806 ATGGTGGAAGAGGTAGTGATAGG - Intronic
1074118348 10:110474677-110474699 TAGGCACAAGAAGTATTGGTTGG - Intergenic
1074293198 10:112157123-112157145 AAGGTACCAGAGCTAGTTGGGGG + Intronic
1074463695 10:113663313-113663335 AAAACTCAAGAGGTAGTGGTGGG + Intronic
1074933855 10:118158256-118158278 AAGGTACAAGAAGGGATGGTAGG + Intergenic
1078234807 11:9474664-9474686 AAGGGAGAAGTGGGAGTGGTGGG + Intronic
1078493203 11:11788491-11788513 AAGGTCCGAAAGGGAGTGGTAGG - Intergenic
1081838576 11:46178074-46178096 AAGGTCTATGAGGTTGTGGTAGG - Intergenic
1082223126 11:49666666-49666688 AATTTACAAGAGGTAGTAGGCGG + Intergenic
1085423731 11:76384848-76384870 AAGCTGCAAGAACTAGTGGTGGG - Intronic
1086625925 11:88952568-88952590 AATTTACAAGAGGTAGTAGGCGG - Intronic
1086845416 11:91743860-91743882 AGGAAACAAGAGGTAGAGGTGGG - Intergenic
1088486066 11:110341733-110341755 AAGGTATAAGAGGAAACGGTAGG - Intergenic
1088741799 11:112773621-112773643 CAGGTTCAAGAGACAGTGGTGGG + Intergenic
1089010938 11:115131169-115131191 AAGGATCAAGAGATATTGGTAGG + Intergenic
1089949341 11:122510658-122510680 AAGGCATCAGAGGTGGTGGTGGG + Intergenic
1090844935 11:130522508-130522530 AAGGTATAGGAGGTGGGGGTGGG + Intergenic
1095404401 12:41851897-41851919 TAGGTATAAGAGTTAGAGGTAGG + Intergenic
1097220713 12:57449384-57449406 AAGGTCCAAGTGGTATTGGAAGG - Exonic
1098607842 12:72415456-72415478 AAGGTATAAGATCTAGTGTTTGG - Intronic
1101002410 12:100369929-100369951 AAGTGACAATAGGGAGTGGTGGG + Intronic
1102701905 12:114846602-114846624 AAGGGGCAATAGGGAGTGGTGGG + Intergenic
1103868284 12:124071589-124071611 AAGGTACAAAAGGTAGAGGATGG + Intronic
1105892798 13:24694064-24694086 AAGGTACAAGCGGATGTGGAGGG - Intronic
1106191536 13:27457926-27457948 AATGTACAAGAGGAGGAGGTGGG - Intergenic
1108776348 13:53769552-53769574 AAGGTGCAAGAAGTTGAGGTTGG + Intergenic
1109636335 13:65122727-65122749 AATGTACAAGAGGTAGTACATGG - Intergenic
1109974128 13:69808310-69808332 AAGAGACAGTAGGTAGTGGTGGG - Intronic
1110867117 13:80408084-80408106 AAGGTCCCAGAGGAAGGGGTGGG - Intergenic
1110888514 13:80669460-80669482 AAAGGACAAGAGATAGTGGCTGG - Intergenic
1119580742 14:75777740-75777762 AAGTTAAATGAGGTAGGGGTAGG + Intronic
1121781260 14:96623952-96623974 GGGGTACAAGAGGGAGTGGAGGG - Intergenic
1124630165 15:31331664-31331686 AGGGTACGAGAGGGAGGGGTGGG - Intronic
1125047098 15:35254644-35254666 GAGGTAAAAAAGGTAGTGCTTGG + Intronic
1125307352 15:38334304-38334326 AGGGTCCAAGTGGTAGAGGTGGG + Intronic
1126431725 15:48592800-48592822 ATGTGACAATAGGTAGTGGTGGG + Intronic
1127723865 15:61728509-61728531 AAGGCACAGGAGGTGTTGGTGGG - Intergenic
1129802407 15:78425255-78425277 AAGGTACAAGTTCTAGTGTTTGG - Intergenic
1130157268 15:81362387-81362409 AAGGTACCAGAGGGAGTGTCTGG - Intronic
1130893121 15:88150150-88150172 AAGGTACAAAAGCAACTGGTGGG + Intronic
1135622503 16:23968039-23968061 AAAGCACAACAGGGAGTGGTGGG - Intronic
1135898938 16:26437986-26438008 CAGGTACAACAAGTAGTTGTTGG - Intergenic
1136062775 16:27737979-27738001 GAGGAACAAGGGGTAGTGGGAGG + Intronic
1136607278 16:31344855-31344877 GAGGTTCAAGAGGGAGGGGTGGG - Intergenic
1140214224 16:72994561-72994583 AAGGTAGAGGAGGTAGGAGTCGG - Intronic
1141153129 16:81578578-81578600 AAGGGACCAGAGGAAGGGGTGGG - Intronic
1143223522 17:5281877-5281899 AAGCTAGAAGAGGTAGAGGCTGG + Intergenic
1144125486 17:12198877-12198899 AATGTACAAAAGGGAGTGGTGGG - Intergenic
1144357469 17:14459821-14459843 CAGGTACAAGAGTTAGGGCTGGG - Intergenic
1144755300 17:17676551-17676573 ATAGAACAATAGGTAGTGGTGGG + Intergenic
1146531313 17:33609872-33609894 AAGGAAAAAGAGGTAGAGGAGGG + Intronic
1147322934 17:39656916-39656938 AAGGGGCAAGAGGTAGGGGATGG - Intronic
1147770835 17:42866888-42866910 AAGGTGCAAGAGGAAGTGGGGGG - Intergenic
1149382289 17:56106256-56106278 AAGGTACAAAAGGGATGGGTGGG - Intergenic
1151815771 17:76470645-76470667 AAGGCAGAACAGGTAGGGGTGGG + Intergenic
1153800845 18:8667134-8667156 AAGGTTGAACAGGTAGTGGCTGG + Intergenic
1155458262 18:26045323-26045345 AAGGTCCAAGAGATAGTTGAAGG - Intronic
1155588884 18:27401659-27401681 AAAGTACAAGAGTCAGTGGGAGG - Intergenic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1162431448 19:10631294-10631316 CAGGTACGTGAGGTAGCGGTCGG - Exonic
1163703031 19:18795966-18795988 AAGGAACAAAAGGCAGGGGTGGG + Intergenic
1164746524 19:30620143-30620165 AAGGTACAATAGGGAGTGGTGGG + Intronic
1165243887 19:34486868-34486890 AAGGTGCAGGAGGTGGAGGTTGG - Intronic
1166432192 19:42737203-42737225 TAGGGTCAAGAGGTAGTGGGGGG + Intronic
1166435308 19:42762396-42762418 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166448174 19:42876386-42876408 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166452574 19:42914599-42914621 TAGGGTCAAGAGGTAGTGGGGGG + Intronic
1166464856 19:43023165-43023187 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166470976 19:43079347-43079369 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166482132 19:43183263-43183285 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166484615 19:43202381-43202403 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166491738 19:43266262-43266284 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166754835 19:45184236-45184258 AGGGTACAAGAGGGTGTGGAAGG + Intronic
1167399455 19:49255330-49255352 GTGGTACAAGAAGTACTGGTGGG + Intergenic
1167675039 19:50878570-50878592 AATTTACTAGAGGTAGGGGTGGG - Exonic
927429740 2:23017386-23017408 AAGGTAAAGGAGGTGGTGGAAGG - Intergenic
927679696 2:25131573-25131595 AAGGGACAACAGGGAGGGGTCGG + Intronic
931180000 2:59890083-59890105 AAGGTTGAAGAGTTAGTGGCTGG - Intergenic
931383263 2:61773490-61773512 CAGGAACAAGAGGGAGTGGCAGG + Intergenic
933288892 2:80414583-80414605 AGAGTACAGGAGGTAGCGGTCGG - Intronic
934057242 2:88261671-88261693 AAGGGGTAAGAGGGAGTGGTGGG + Intergenic
934104288 2:88681709-88681731 AAGCTACAGGAGGAAGTGGGAGG - Intergenic
936885498 2:117306308-117306330 AGGGTAGGGGAGGTAGTGGTGGG + Intergenic
937831370 2:126427977-126427999 AAAGTACAAATGGCAGTGGTAGG - Intergenic
938889961 2:135694285-135694307 AAGGTAGAAGAGGTATGTGTTGG + Intronic
939482120 2:142762099-142762121 AAGGTATTAGTGGTAGTGATGGG - Intergenic
940760591 2:157734430-157734452 AAGGAACAAAGGGAAGTGGTTGG + Intergenic
941799448 2:169640960-169640982 AAGGTATGTGAGGGAGTGGTGGG + Exonic
942183963 2:173406750-173406772 AAGAACCAGGAGGTAGTGGTTGG - Intergenic
942414099 2:175740356-175740378 AAGTTATAAGAAGTAGTGGAGGG - Intergenic
943249704 2:185502623-185502645 ATGTTGCAAGAGTTAGTGGTTGG - Intergenic
943533052 2:189111480-189111502 AAGGAAGGAGAGGTAGTGCTGGG - Intronic
945501825 2:210585173-210585195 AAGGTACTATAGGCAGTGCTGGG - Intronic
947266631 2:228289438-228289460 AAGGAAAAATAGGTAGTGGTGGG + Intergenic
947443566 2:230144521-230144543 AAGGGAAGAGAGGAAGTGGTAGG + Intergenic
947562213 2:231165760-231165782 AAGGTACAAGAGGTAGTGGTCGG - Intronic
947788767 2:232849652-232849674 AAGGCACAGGTGGTAGTAGTGGG - Intronic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
1172380650 20:34487620-34487642 ATTGTACAAGAAGTAGTGTTTGG - Intronic
1172681218 20:36716822-36716844 CAGGTACAAGAGGCAGTAGATGG + Intronic
1173233511 20:41221910-41221932 AAGGTCAAAGAGGCTGTGGTAGG + Intronic
1174406230 20:50305088-50305110 GAGAGACAAGAGGGAGTGGTGGG - Intergenic
1174875734 20:54224288-54224310 AACGGACAAGAGGTAATAGTTGG + Intronic
1178660227 21:34501626-34501648 TGGGTCCAAGAGGTGGTGGTTGG + Intergenic
1181959601 22:26613330-26613352 AAGGTAGAAGTGGAAGTGCTGGG - Intronic
1182994228 22:34798293-34798315 AAGATACAAGAGGAAGAAGTGGG - Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952866326 3:37857645-37857667 GAGCTCCAAGAGGGAGTGGTTGG - Intergenic
955082376 3:55669968-55669990 AATGTAGAGTAGGTAGTGGTAGG + Intronic
955233949 3:57123373-57123395 AAGGTGCAAGAGGGAGTGACTGG - Intronic
957505527 3:81115847-81115869 AAGGTGCAGGAGGTGGGGGTGGG + Intergenic
958196487 3:90247494-90247516 AGGGTACAAGAGATAGTGAGGGG + Intergenic
958675718 3:97265769-97265791 AAGGCACAAGCGGTGGTGGCAGG - Intronic
960253188 3:115480379-115480401 ATGGAACAAGGGCTAGTGGTGGG + Intergenic
960320836 3:116233548-116233570 AAGGAATAAGAGCTAGTGTTTGG - Intronic
961906555 3:130268943-130268965 AAGTTACAGGAGGTTGTGCTCGG - Intergenic
961919085 3:130407270-130407292 GAGGTTCAAGAGGTGGTGGTGGG + Intronic
962881499 3:139581241-139581263 AAGCTACAAGAGGTATTTTTGGG + Intronic
963200531 3:142581410-142581432 CAGGTACAAGAGGAAGTACTCGG + Intergenic
964426437 3:156559148-156559170 ATAGGACATGAGGTAGTGGTAGG + Intergenic
964709466 3:159656402-159656424 AAGGTACAAGAGGAGGTTGTGGG - Intronic
965015715 3:163154015-163154037 AAAGTAGAAGAAGTAGTGGAAGG - Intergenic
970513880 4:16807950-16807972 AAGGTACAACAGGTGAAGGTAGG + Intronic
976355379 4:84110987-84111009 AATGGAAAAGAGGTAGTGGGAGG - Intergenic
977055865 4:92189533-92189555 GAGGAACAAGAGGTAGAGGAGGG + Intergenic
977149799 4:93496543-93496565 AAGTTACCAGAGGTTGGGGTTGG - Intronic
977151830 4:93522170-93522192 AAGTTAGAAGATGTGGTGGTGGG + Intronic
980893631 4:138840317-138840339 AAGGTAGAGGAGGCAGTGATTGG - Intergenic
981249418 4:142581878-142581900 AAAGTACAAGAGGTAATGGCTGG + Intronic
981736193 4:147953834-147953856 AAGGTACAAAATGAAGTGCTTGG + Intronic
982284863 4:153724344-153724366 TTGGTACAAGAGGTAGTGGATGG + Intronic
983273893 4:165594416-165594438 AAGGTATAGGAAGTATTGGTGGG + Intergenic
983519899 4:168697317-168697339 AAAGGACAAGATGTAGAGGTGGG + Intronic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
986354706 5:6912351-6912373 GAGGTTCAGGAGGTAGTGGATGG + Intergenic
986786912 5:11123091-11123113 AAGGTAGAAAAGGCAGTGCTTGG - Intronic
987934294 5:24443918-24443940 AATGTGCAAGAGGCAGTGGAAGG + Intergenic
988249468 5:28737183-28737205 AAGATACAAGAGAAAGTGATAGG + Intergenic
988524252 5:31972785-31972807 GTGGTACAACAGGGAGTGGTGGG - Intronic
989377393 5:40778678-40778700 AAGGTATAAGAGGTTATGGATGG - Intronic
990827467 5:59917462-59917484 GAGCTACAAGAGGTAGTGAAAGG + Intronic
991006859 5:61836522-61836544 AAGTTTCCACAGGTAGTGGTAGG + Intergenic
991937706 5:71818144-71818166 GAGGCAGAAGAGGTAGGGGTGGG + Intergenic
992255750 5:74919439-74919461 AAGTTACAGGAGGTCGAGGTGGG + Intergenic
993986247 5:94601201-94601223 AAGCTCCCAGAGGTAGCGGTAGG + Intronic
1001574750 5:172755950-172755972 AGGGTACAAGAGGGAGAGGGAGG + Intergenic
1006903971 6:37520971-37520993 AGGGTGCTAGAGGCAGTGGTGGG - Intergenic
1007938060 6:45751503-45751525 AAGATAGAAGTGGTGGTGGTGGG - Intergenic
1009544068 6:65002475-65002497 CAGATATAAAAGGTAGTGGTGGG - Intronic
1009550038 6:65078900-65078922 CAGGAACAAGAGGGAGTGGGAGG - Intronic
1010668765 6:78661089-78661111 AAGGTAAAAGAAGTGGGGGTTGG - Intergenic
1010921411 6:81686215-81686237 AAGGTAAAAGAGATACTGTTTGG - Intronic
1012537750 6:100319777-100319799 AAGGAATAAGAGGCAGTGTTTGG - Intergenic
1012961417 6:105625941-105625963 ATGGTACAAGAGGTCGTGTGTGG - Intergenic
1013760745 6:113514164-113514186 AAAGTACAAGATTTAGTTGTTGG + Intergenic
1014013928 6:116507745-116507767 AAGGAACAAGTGGTAGTGGTGGG + Intronic
1015598161 6:134886278-134886300 CAGGTACAAGATCTAGTGCTAGG - Intergenic
1018631107 6:165823360-165823382 ATGGGACAAGAGGTGGAGGTGGG - Intronic
1022558537 7:31325333-31325355 AGGGTACAGGAGGTACTGGGAGG + Intergenic
1023575730 7:41624453-41624475 AAGGAAAAGGAGGTAGTGTTAGG + Intergenic
1023585040 7:41720304-41720326 AAGGGAGGAGAGGAAGTGGTGGG - Intergenic
1023599260 7:41865307-41865329 AAGCGACAGGAAGTAGTGGTGGG - Intergenic
1023925574 7:44667056-44667078 CAGATACAAGAGGTTGGGGTGGG - Intronic
1024150654 7:46568499-46568521 AAGGTACAAGAGTTACAGGCGGG + Intergenic
1024695545 7:51853040-51853062 AAGGAACAAGAGGTTGTGCTGGG - Intergenic
1025790290 7:64681873-64681895 ACGGAATAATAGGTAGTGGTGGG - Intronic
1028404085 7:90457333-90457355 AAGGTAAAAGAGGTAGCCGAGGG + Intronic
1029412050 7:100419610-100419632 AAGGTACCAGTCATAGTGGTGGG - Exonic
1030066228 7:105661304-105661326 AAGGTACCAGGGGTAGAGATGGG + Intronic
1032178108 7:129649708-129649730 AAACTACAAGAGGTTGGGGTAGG - Intronic
1035825856 8:2643598-2643620 AAGGAACAAGCGGTGGTGGACGG - Intergenic
1040017017 8:42708067-42708089 ATGGGACCAGAGGTAGGGGTCGG + Intronic
1040488071 8:47893254-47893276 AAGGTACAAGAGGGTGGGCTGGG + Exonic
1045697733 8:104829152-104829174 AAGGTATAAGAGGTAGGTGGTGG + Intronic
1048508758 8:135043676-135043698 AAGGTACAAAAAATACTGGTGGG + Intergenic
1051709710 9:19919160-19919182 GAGTTAGAAGAGGTTGTGGTGGG + Intergenic
1056329095 9:85507208-85507230 TAGGTACATGGGGTGGTGGTGGG - Intergenic
1059635005 9:116161723-116161745 AAGGTTCTGGGGGTAGTGGTTGG + Intronic
1059872547 9:118594067-118594089 AAGGTACAAGAGTTAGTTTGGGG - Intergenic
1187689990 X:21856728-21856750 CAGACACAAGAGGAAGTGGTGGG + Exonic
1190997080 X:55620235-55620257 AAAGTAAAAAAGGTAGTTGTGGG - Intergenic
1193486265 X:82088291-82088313 AAGGTATATGAGGAAGTGGAAGG - Intergenic
1196287856 X:113903061-113903083 AAAATACAAGAAGTACTGGTGGG - Intergenic
1197200096 X:123741327-123741349 AAGATTCAAGGGGTAGAGGTAGG - Intergenic
1198026438 X:132712287-132712309 GAGATACAAAAGGAAGTGGTGGG - Intronic
1201550343 Y:15211625-15211647 AAGGTGCAAGAGGGAGAGGGAGG + Intergenic