ID: 947562333

View in Genome Browser
Species Human (GRCh38)
Location 2:231167293-231167315
Sequence GTGTCCTAATACATCTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947562333 Original CRISPR GTGTCCTAATACATCTGTTC TGG (reversed) Intronic
901305670 1:8231096-8231118 GTCTCCTTAGACTTCTGTTCAGG - Intergenic
910295488 1:85640527-85640549 GTGGCCTAACATATCTGTTCTGG - Intergenic
910972914 1:92874498-92874520 GTTTCCAAATACATCTGACCAGG + Intronic
914742313 1:150475208-150475230 GAGTCCTAAGACATTTGTTAGGG + Intronic
917096299 1:171402485-171402507 GTGGCCTAACATATCTATTCTGG - Intergenic
922488182 1:225993002-225993024 TTCTCCAAATACATCTGCTCAGG - Exonic
1064774178 10:18757016-18757038 CTGTTCTAATACAGCAGTTCAGG - Intergenic
1065897686 10:30178579-30178601 GGGTCTTAACACATCTGTTCAGG - Intergenic
1066343682 10:34561471-34561493 GCTTCCTAAGACATCTGTTGTGG - Intronic
1069892317 10:71659640-71659662 GTGTATTATTACATGTGTTCAGG - Intronic
1074419950 10:113299833-113299855 GTGCCCAAATACCTCTGTCCTGG - Intergenic
1079722036 11:23827382-23827404 GTTTCCTAAGACATCAGTGCAGG + Intergenic
1083050051 11:59769041-59769063 GTTTCCCAATACATGTGTGCAGG - Intronic
1087332838 11:96804026-96804048 TTGTCCTAGTACCTCTATTCTGG - Intergenic
1090848557 11:130550436-130550458 GTGTCCTATTGCCTCTGTACAGG + Intergenic
1099934230 12:89106584-89106606 GTGTCCTAAGCCATCCGTCCTGG - Intergenic
1104669436 12:130670269-130670291 GAGTCCTAAAACTTCAGTTCTGG - Intronic
1105897265 13:24726911-24726933 GTGTCCTTTTACAGCTGTCCTGG - Intergenic
1106607628 13:31244699-31244721 GTGTAATATTACATCTGTTTGGG + Intronic
1107463368 13:40627060-40627082 GTGTTCTAATGCTTGTGTTCTGG - Intronic
1110309142 13:74026887-74026909 GTGCCCTGATACAGCTTTTCAGG + Intronic
1113212260 13:107997542-107997564 GTGACCTAATTCATCTCTTATGG + Intergenic
1117123421 14:52594205-52594227 GTGTTCTTTTACATTTGTTCAGG + Intronic
1119890476 14:78178711-78178733 GTGTCCTCATTTATCTGTTGAGG + Intergenic
1128453210 15:67819205-67819227 TTTTCCTAATACCTCTGCTCAGG + Intergenic
1134335117 16:13291673-13291695 GTGTCATGAGACATCTTTTCTGG - Intergenic
1139463075 16:67138188-67138210 GTGGCCTAACACATTTCTTCAGG - Intronic
1141119992 16:81346294-81346316 GTGTCCTAATAAGTCAGCTCTGG - Intronic
1146835657 17:36108562-36108584 GTGTCCTGCTTCATCTGTTCTGG - Intergenic
1157471718 18:47994028-47994050 GTGGCCTGCAACATCTGTTCAGG + Intergenic
1160545393 18:79649623-79649645 TTTTCCTAACACATTTGTTCTGG - Intergenic
926054305 2:9765421-9765443 GTGTCCAACCACCTCTGTTCAGG - Intergenic
926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG + Intergenic
927420459 2:22925544-22925566 GTGAGCAAATACATCTGCTCAGG - Intergenic
927976586 2:27343073-27343095 GTGTCCTACCACCTCTCTTCCGG + Exonic
928016385 2:27661822-27661844 GTATCTTGATACATCTGTGCTGG + Intronic
928134103 2:28675153-28675175 GTGTCCCTACTCATCTGTTCTGG - Intergenic
935136030 2:100303113-100303135 TTGTTCTAATAAATTTGTTCAGG - Intronic
939222771 2:139324391-139324413 GTTTTCTAATACAGATGTTCAGG - Intergenic
941226547 2:162856916-162856938 GTGTGATAATACATCATTTCTGG - Intergenic
941236061 2:162975588-162975610 GTGTTCAAATACCTCTGTTTTGG - Intergenic
941346814 2:164379767-164379789 GTGTCCTATTAAATCAATTCTGG + Intergenic
942089951 2:172480264-172480286 CTGTCCTAAACCATCTGCTCTGG - Intronic
942872599 2:180753397-180753419 GGGCCCTAAAACATCTGTTCTGG - Intergenic
947399669 2:229718452-229718474 GGGTCCTGATAGAACTGTTCTGG - Intergenic
947562333 2:231167293-231167315 GTGTCCTAATACATCTGTTCTGG - Intronic
1173650644 20:44661970-44661992 GAGTATTCATACATCTGTTCAGG + Intergenic
1177352651 21:19964636-19964658 GTCTGCTAATATATCTGTGCAGG - Intergenic
1183004323 22:34888493-34888515 GTGTCTTAATCCATCCATTCAGG + Intergenic
949174399 3:1041562-1041584 GTGACCTAACAAATCTGTTCTGG + Intergenic
961336447 3:126182721-126182743 ATTTCCTAATACATCTTTTTGGG - Intronic
964413595 3:156424876-156424898 GTGTCTTATTACAAGTGTTCAGG - Intronic
964823890 3:160804643-160804665 GTGACCTAATAGATTTGTTTAGG - Intronic
966728389 3:183129830-183129852 GTGTCCTAATACATGTTCTGTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973950897 4:56012855-56012877 GTATACAAATATATCTGTTCGGG + Intronic
976335373 4:83879231-83879253 ATGGACTAATACATCTGGTCTGG + Intergenic
978919476 4:114165339-114165361 GATTCCTAATACCACTGTTCAGG - Intergenic
983710243 4:170706337-170706359 CTGTCCTCAAACATCTGTACAGG + Intergenic
983839923 4:172444818-172444840 CTCTCCTAATAAATGTGTTCAGG - Intronic
985032739 4:185806908-185806930 TTGTCCTAGTACATTTTTTCTGG - Intronic
988167349 5:27611151-27611173 GTGACCAAATACAACTGATCAGG - Intergenic
988534482 5:32054109-32054131 GTGGCTTAATACTTCTGTTGGGG + Intronic
990895793 5:60699486-60699508 CTCTCCTAAAACATCTGTCCTGG + Intronic
992548468 5:77838963-77838985 GTCTGCAAATACATCTGCTCAGG + Intronic
994146237 5:96398765-96398787 GTCTCCTAATAGATATTTTCAGG - Intronic
994174101 5:96692187-96692209 GTGAGCTAAGAGATCTGTTCAGG + Intronic
994622267 5:102177603-102177625 GTGTCTTATTACATCTCTACCGG - Intergenic
995014456 5:107294168-107294190 GTGTCTTAAGATAGCTGTTCAGG - Intergenic
1000768550 5:165321245-165321267 CTGTCATAATATATCTGTTGGGG - Intergenic
1001567992 5:172712960-172712982 CTGTATTAATACATCTGTGCAGG + Intergenic
1003505269 6:6735288-6735310 CTGTCCCAGTGCATCTGTTCAGG + Intergenic
1004303377 6:14478268-14478290 GTGTCAAAATACATCGCTTCAGG + Intergenic
1008546485 6:52588243-52588265 GAGTCCTTGCACATCTGTTCAGG - Intergenic
1009376140 6:62972014-62972036 GTCTGCTACTACAACTGTTCAGG - Intergenic
1011007960 6:82669307-82669329 GTGTCCTTGTAAATCTCTTCTGG - Intergenic
1011019745 6:82799074-82799096 GGGTCCTAATCCATCTGGACTGG + Intergenic
1013949682 6:115764720-115764742 GTGCCCTAATACAGATGGTCAGG + Intergenic
1015920501 6:138261982-138262004 GTATTCACATACATCTGTTCAGG + Intronic
1016035806 6:139381637-139381659 GTGACTTAATACATATGTTCTGG + Intergenic
1017883856 6:158582424-158582446 GTGTCTTAATACTTCTGTCAGGG - Intronic
1021506663 7:21393046-21393068 GAGTCTTAATACATAGGTTCAGG - Intergenic
1028966541 7:96808055-96808077 GTGTTTTACTACATCTGTTAGGG + Intergenic
1031751523 7:125580847-125580869 GTGTCCAAATATTTCTCTTCAGG - Intergenic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1039749557 8:40464555-40464577 CAGTCCTAGTTCATCTGTTCTGG - Intergenic
1041187611 8:55317092-55317114 GTGTACATAGACATCTGTTCTGG + Intronic
1041666113 8:60446633-60446655 TTGTCCTAAGATACCTGTTCAGG - Intergenic
1045337280 8:101218305-101218327 TTGTTATAATTCATCTGTTCAGG - Intergenic
1046793227 8:118343663-118343685 TTGTTCTAATACACCTCTTCAGG - Intronic
1047074463 8:121384553-121384575 CAGTCCTATGACATCTGTTCTGG - Intergenic
1050974429 9:11919131-11919153 ATGTCATTATACATCTGTTGAGG + Intergenic
1055868718 9:80847579-80847601 ATGTCTTAATACATCTGTGGAGG - Intergenic
1056983313 9:91337583-91337605 GTGGCCTAAAACTTCAGTTCTGG - Intronic
1188394065 X:29658484-29658506 GTGTCCTAACACATGAGTTACGG - Intronic
1190480625 X:50873084-50873106 CTGTCCCAAAACATTTGTTCAGG - Intergenic
1193099023 X:77586608-77586630 GAGTACTAATCCAACTGTTCTGG + Intronic
1198894046 X:141430937-141430959 GCGTGTCAATACATCTGTTCTGG + Intergenic