ID: 947562670

View in Genome Browser
Species Human (GRCh38)
Location 2:231171201-231171223
Sequence AAAATACTGTCGAAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947562670_947562675 15 Left 947562670 2:231171201-231171223 CCCATCTCCTTCGACAGTATTTT 0: 1
1: 0
2: 0
3: 11
4: 169
Right 947562675 2:231171239-231171261 AACATTCATTCATTCTATGATGG 0: 1
1: 0
2: 1
3: 37
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947562670 Original CRISPR AAAATACTGTCGAAGGAGAT GGG (reversed) Intronic
914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG + Intronic
916704309 1:167332416-167332438 AAAAAACTGGGGATGGAGATGGG - Intronic
917248146 1:173027051-173027073 AAAATACTGCTGAAAGAAATTGG - Intergenic
919197222 1:194301438-194301460 GAAATACTGTTGAATGAGAGGGG - Intergenic
1064729245 10:18312760-18312782 AAAATACAGGCAAAGGAGACAGG - Intronic
1067494958 10:46753555-46753577 AAAACACTGCCCTAGGAGATGGG + Intergenic
1067599698 10:47586841-47586863 AAAACACTGCCCTAGGAGATGGG - Intergenic
1068740159 10:60459826-60459848 AAAATATTGGCAAAGGAGATTGG - Intronic
1076079426 10:127565415-127565437 AAAATACTGTCCAAAGGGAGAGG + Intergenic
1077699022 11:4422652-4422674 AGAATACTTTTGAGGGAGATAGG + Intergenic
1080808365 11:35677853-35677875 AACAAACTGGGGAAGGAGATAGG + Intronic
1080856892 11:36120337-36120359 AATATTCTGGTGAAGGAGATTGG - Intronic
1081163550 11:39782380-39782402 AAAATAAAGTGGGAGGAGATGGG - Intergenic
1082813083 11:57490398-57490420 GATATACTGTGGAAGGAGACTGG - Intronic
1085702379 11:78756609-78756631 AAACTACTCTCCAAGGAGTTTGG - Intronic
1088409447 11:109517531-109517553 AAAATACTGCTGAGGCAGATAGG - Intergenic
1089879308 11:121758204-121758226 AAACTTCTGTCTAAGGAGAAGGG - Intergenic
1090146215 11:124325842-124325864 AAAATACTGTGGGAAGAGCTGGG - Intergenic
1093670109 12:21863805-21863827 AAAGTACTGATGAAGGAAATAGG + Intronic
1094123765 12:27000904-27000926 AAAAAACTTTCCAAGCAGATGGG - Intronic
1097706828 12:62877444-62877466 AAAATGCTTTTGAAGGAGCTCGG - Intronic
1101405709 12:104426750-104426772 AAATTACTTTTGAAGGGGATCGG + Intergenic
1101687088 12:107035722-107035744 AAAATAGAGTAGAAGGATATCGG + Intronic
1103119036 12:118365135-118365157 AAGATACAGTGGAAGGAGAGAGG - Intronic
1103311822 12:120015865-120015887 AAAATATTGTAGAAGGTCATTGG - Intronic
1103450859 12:121027812-121027834 CACATACTGTTGAAAGAGATGGG + Exonic
1105020765 12:132815275-132815297 CAAACACTGACGCAGGAGATAGG + Intronic
1106539175 13:30674590-30674612 GAAAAACTGTCTAAGGAGAAGGG - Intergenic
1106953604 13:34911599-34911621 AAAATACTGATGGAGGAGAAGGG - Intergenic
1107665246 13:42681639-42681661 AACATACTGTGGAGGGAGAGTGG - Intergenic
1108780621 13:53826745-53826767 AAAATACTGCCCAGGGAGTTTGG + Intergenic
1109707091 13:66110089-66110111 AAAATCCAGTTCAAGGAGATAGG - Intergenic
1110332222 13:74285937-74285959 GAAATACTGTAGGAAGAGATAGG - Intergenic
1111686949 13:91513811-91513833 AAAAAGCTGTGGAAGGAGATGGG - Intronic
1112452037 13:99521488-99521510 AATAAAATGTCGAGGGAGATGGG - Intronic
1112835539 13:103509691-103509713 AAAATACCATGGTAGGAGATTGG + Intergenic
1113614239 13:111669699-111669721 AAAATACTTTCTAAGGAGCAAGG + Intronic
1113619707 13:111754613-111754635 AAAATACTTTCTAAGGAGCAAGG + Intergenic
1115042449 14:28948194-28948216 AAAATACTGTCCAGGAAAATGGG - Intergenic
1115451871 14:33557255-33557277 AAAATACTGTCTAAGGGAACTGG - Intronic
1116787550 14:49304178-49304200 AATATACCATTGAAGGAGATGGG + Intergenic
1117175960 14:53147051-53147073 AAAATATTGGCAAAAGAGATTGG - Intronic
1117347726 14:54850266-54850288 AAAAAATTGACAAAGGAGATCGG - Intronic
1117643957 14:57831199-57831221 GAGATACTGTGGAAGGAGAATGG - Intronic
1118688920 14:68319415-68319437 AAAAAACTGTCCAAGGAGCCTGG + Intronic
1135434332 16:22415788-22415810 ATAATACTGTGCATGGAGATTGG + Intronic
1138401833 16:56751945-56751967 AAAGGACTGACGAAGGAGACAGG - Intronic
1143398326 17:6621311-6621333 AAAATGCTTTTGAAGCAGATGGG - Intronic
1146710274 17:35035000-35035022 AAAATAGTGTGGAGGAAGATGGG - Intronic
1146754373 17:35414434-35414456 AAAATGCTGATGAAGGAAATTGG + Intronic
1147344198 17:39777073-39777095 AAAATACAGCAGAATGAGATGGG - Intronic
1148262480 17:46195125-46195147 AAAATACAGTAGAAGGGTATTGG + Intronic
1150426518 17:65081630-65081652 AAAATACAGTAGAAGCAGAAAGG + Intergenic
1150900155 17:69265247-69265269 GAAATACTGTGGAAACAGATGGG + Intronic
1154247436 18:12711702-12711724 AAAATACTCTCTAAGGACACAGG - Intronic
1155186946 18:23395391-23395413 AACATACTGGGGATGGAGATGGG - Intronic
1156774191 18:40767183-40767205 AAAATACTGTAGTAGAAGATGGG + Intergenic
1157081701 18:44532617-44532639 AATAAAATGTTGAAGGAGATGGG + Intergenic
1157491869 18:48129207-48129229 AAAAAACTGCCAAAGGAGAGTGG + Intronic
1162883015 19:13674332-13674354 AAAATGCAGTGGAAGTAGATAGG - Intergenic
1163387985 19:17011809-17011831 AAGATACTGGGGAAGGAGTTTGG + Intronic
1165368554 19:35386527-35386549 AAAATACTTTTGTAGGAGAAAGG - Intergenic
1168211071 19:54890586-54890608 AAAATACTGTAAAAGTAGCTGGG - Intergenic
925221824 2:2148000-2148022 AGAATGCTGTTGGAGGAGATTGG + Intronic
933024930 2:77244502-77244524 AAAAAAATGTTTAAGGAGATTGG + Intronic
934075728 2:88427306-88427328 AAAATACTGTTTAAGGACAAGGG + Intergenic
935191267 2:100780543-100780565 AAAGCACTGTCCAAGGAGAAAGG - Intergenic
935635828 2:105248973-105248995 AACCTACTGTGGAAGAAGATGGG + Intergenic
939221409 2:139306530-139306552 AGAATACTATTGAAGGACATAGG - Intergenic
939240392 2:139551411-139551433 AAAATACTCTCCAAGGACATTGG + Intergenic
939504502 2:143028897-143028919 AAAATACTTTTAAAGGAAATTGG - Intronic
942208907 2:173650964-173650986 AAAATATTGTTGGAGGAGAAGGG - Intergenic
942297925 2:174535186-174535208 AAAATTGGGTGGAAGGAGATAGG + Intergenic
943501094 2:188690391-188690413 AAAATACTGTCAAACCAGCTGGG - Intergenic
946875522 2:224126050-224126072 GAAATACTTTCCAAGGAGACCGG + Intergenic
947220390 2:227786219-227786241 AAAACACTGTAGAAGAAGCTCGG + Intergenic
947562670 2:231171201-231171223 AAAATACTGTCGAAGGAGATGGG - Intronic
1170758305 20:19224745-19224767 AAACTAATGTCAAAGGAAATTGG + Intronic
1170858702 20:20082389-20082411 TAATTACTGTCTAAGTAGATGGG - Intronic
1175060295 20:56236104-56236126 TAAATACTGTAGAAGGATTTAGG + Intergenic
1177480432 21:21679459-21679481 AAAATACTGTGCAAAGAAATTGG - Intergenic
950861707 3:16153104-16153126 AAATTACTGGCAAAGGAGAGGGG - Intergenic
950874234 3:16255618-16255640 AAAATACAGTGGAAGTAGAGTGG - Intergenic
951714481 3:25625093-25625115 AAACTACTGTTAAAGGAGTTTGG - Intronic
955169439 3:56549055-56549077 ATAAAAGTGTTGAAGGAGATGGG - Intergenic
955679844 3:61489001-61489023 GAAATACTTTGGCAGGAGATGGG - Intergenic
958077968 3:88708960-88708982 AAAATTCTGTCTCAGGAGATGGG + Intergenic
958179231 3:90036221-90036243 AAAATACAGTCCAAGGATTTTGG + Intergenic
958965937 3:100558316-100558338 AAAATTCTGTCTACGGAGAGAGG + Intronic
959464891 3:106673384-106673406 AAAATATTTTTGAAAGAGATGGG - Intergenic
959783397 3:110264199-110264221 AACCTACTTTCAAAGGAGATAGG + Intergenic
959915559 3:111813137-111813159 AAAAAACTGTAGGAGGAGTTGGG + Intronic
965359063 3:167714767-167714789 AAAACACTGACGAAGGCAATTGG + Intronic
971090259 4:23335022-23335044 AAAATAGTCTCGAAGATGATGGG - Intergenic
971566629 4:28151450-28151472 AAAATACTATCCAAGTAAATAGG + Intergenic
972148470 4:36059793-36059815 AAAATGCTGTAGATGGTGATAGG + Intronic
976926654 4:90505951-90505973 AAAGTACTGTGGAAGGAGAGAGG - Intronic
979721610 4:123906372-123906394 AAAATAGTGTCCAAGAAGACTGG + Intergenic
982936730 4:161487498-161487520 TAAATACTGTTAAAGTAGATAGG - Intronic
982985517 4:162201137-162201159 AAAATACTGTAAAGGGAGATGGG + Intergenic
990136960 5:52657326-52657348 AAAATGCTGCGGAAGGAGTTGGG - Intergenic
991179249 5:63729773-63729795 AGAATAGTGTTGAAGGATATTGG + Intergenic
991224322 5:64251914-64251936 AAAATATTGATGAAGGAAATTGG + Intronic
991349184 5:65702974-65702996 AAAATATTTTCAAAGAAGATGGG + Intronic
991708342 5:69381958-69381980 AAAATACTATCAAAGGAGCATGG + Exonic
992078668 5:73214706-73214728 AAAATACTTTCTAAGCAGCTGGG + Intergenic
992179856 5:74185221-74185243 TATATACTGTGGAAGGTGATGGG - Intergenic
992288522 5:75261051-75261073 AAAAGAATGTTGAAGGAGAAAGG - Intergenic
992305516 5:75433358-75433380 AAAACACTGCTGAAGGAAATTGG - Intronic
993116520 5:83725834-83725856 AAAAAGCTGACAAAGGAGATGGG - Intergenic
993174444 5:84465682-84465704 AAAATACTGATGTAGGAGAGAGG + Intergenic
994167550 5:96623619-96623641 AAAATAATGTCAGAGGAGAAAGG - Intronic
997311119 5:132883953-132883975 AAAAAACTGTGGTAGAAGATGGG + Intronic
1001401123 5:171446970-171446992 AAAATATAGTGGAAGGATATCGG - Intronic
1003344031 6:5248714-5248736 AGAATATTGTGGAAGCAGATAGG - Intronic
1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG + Intergenic
1003902037 6:10663364-10663386 AACATAGTGTGGAGGGAGATGGG - Intergenic
1004710788 6:18168218-18168240 AAAATACTTTGGAATTAGATAGG - Intronic
1007734903 6:43975572-43975594 AAAATATTGTGGAAGGACAGAGG - Intergenic
1009213322 6:60889242-60889264 AAAACACTGTTGAAAGAAATCGG + Intergenic
1009371615 6:62910839-62910861 AAAACACTGTTGAAAGAAATTGG + Intergenic
1009667409 6:66702679-66702701 ACAAGACTGTCGAGGGAAATAGG - Intergenic
1010611702 6:77961817-77961839 AAAATACTGCCGAAAGATATCGG - Intergenic
1015490794 6:133823418-133823440 AATATACTGAGGAAGGAAATGGG - Intergenic
1016196295 6:141346622-141346644 AAAATACTGTCTGAAGAGACAGG - Intergenic
1016304988 6:142674641-142674663 AAAAGACTGTTAAAGGAGACAGG - Intergenic
1016772017 6:147862240-147862262 AACATACTCTCGAGGGAGAAAGG - Intergenic
1018653432 6:166010081-166010103 AAACCACTGTAGAAGGAGAATGG + Intergenic
1020552618 7:9625674-9625696 AATATACTGACGATGGAGAATGG + Intergenic
1021072582 7:16259895-16259917 AAAATACTGGAGAATGAGAAAGG + Intronic
1021440718 7:20671183-20671205 AAAATAATGACAAAGTAGATTGG - Intronic
1023579484 7:41666089-41666111 AAAATACTTACTAATGAGATTGG - Intergenic
1028100794 7:86817993-86818015 AAGATAATGTCTAAGGAGGTAGG - Intronic
1028329243 7:89568155-89568177 AAAATACTGTTGAAAGAAATTGG - Intergenic
1028711394 7:93913018-93913040 AAAATACTCTTGAGGTAGATTGG - Intergenic
1030877299 7:114831028-114831050 AAATTCCTGTCGAAGGGGCTGGG + Intergenic
1032407292 7:131665802-131665824 AAGATACTGTTGGAGGAGCTGGG - Intergenic
1032597655 7:133257836-133257858 AAAATACTCTCCAAGGAGGAAGG - Intronic
1033471340 7:141652526-141652548 AAAATACTCTGGGAGGAGATAGG + Intronic
1037746026 8:21645143-21645165 AAAATACTGTCTAAGCATAAGGG + Intergenic
1037798847 8:22020069-22020091 AAAACACTGATGAAGGAAATTGG + Intergenic
1040460042 8:47638683-47638705 AAAGTATTGTCTATGGAGATAGG - Intronic
1041717887 8:60948591-60948613 AAATGACAGTTGAAGGAGATGGG - Intergenic
1041779476 8:61561625-61561647 AAAATACTGTAAAAGGAGTAGGG + Intronic
1044821578 8:96159254-96159276 ACAATAATGTGGAAGGAGACAGG - Intronic
1045174179 8:99703593-99703615 AAAATACTATAGAATGGGATGGG - Intronic
1045913125 8:107433939-107433961 CAAATACTGTGAAAGGTGATAGG + Intronic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1048353308 8:133633380-133633402 AAAATGCTGTGGAAGGTCATGGG - Intergenic
1051015158 9:12465467-12465489 AAAATATTGGAGAAGCAGATGGG + Intergenic
1054725395 9:68645151-68645173 AAAATAATGTAGTAGGAGTTAGG - Intergenic
1055207253 9:73747359-73747381 AAAATACTGCTGAAAGAAATCGG - Intergenic
1057295735 9:93838291-93838313 AAAACACTGATGAAGGAAATTGG - Intergenic
1059001517 9:110353503-110353525 AAAAAAGTGTATAAGGAGATGGG - Intergenic
1059085407 9:111296578-111296600 AAAATGCTGTTGAAGCATATAGG + Intergenic
1186402381 X:9271633-9271655 AGAATACTCTCCAAGGAGAGAGG - Intergenic
1188539453 X:31233290-31233312 AGAATAGAGTTGAAGGAGATTGG - Intronic
1190689174 X:52899310-52899332 AAAATATTGTCCAAGGAGCCAGG - Intronic
1190696809 X:52956482-52956504 AAAATATTGTCCAAGGAGCCAGG + Exonic
1194442688 X:93952472-93952494 AAAATACTGTTGAAAGAAATTGG - Intergenic
1196416768 X:115479432-115479454 AAAGTAGTATGGAAGGAGATGGG + Intergenic
1196654108 X:118199088-118199110 AGAATACTGGAGAAGGAGGTTGG - Intergenic
1196951436 X:120879225-120879247 AAAACACCGTAGAATGAGATCGG - Intronic
1196951578 X:120930714-120930736 AAAACACCGTAGAATGAGATCGG - Intronic
1196952262 X:120935575-120935597 AAAACACCGTAGAATGAGATCGG - Intronic
1196952947 X:120940436-120940458 AAAACACCGTAGAATGAGATCGG - Intronic
1196953632 X:120945296-120945318 AAAACACCGTAGAATGAGATCGG - Intronic
1196954317 X:120950157-120950179 AAAACACCGTAGAATGAGATCGG - Intronic
1196955000 X:120955017-120955039 AAAACACCGTAGAATGAGATCGG - Intronic
1196955689 X:120959900-120959922 AAAACACCGTAGAATGAGATCGG - Intronic
1196956370 X:120964761-120964783 AAAACACCGTAGAATGAGATCGG - Intronic
1196957052 X:120969621-120969643 AAAACACCGTAGAATGAGATCGG - Intronic
1196957734 X:120974481-120974503 AAAACACCGTAGAATGAGATCGG - Intronic
1196958416 X:120979341-120979363 AAAACACCGTAGAATGAGATCGG - Intronic
1196959097 X:120984201-120984223 AAAACACCGTAGAATGAGATCGG - Intronic
1197832337 X:130656945-130656967 AAAATACTGTCTAATATGATAGG - Intronic
1197920824 X:131591933-131591955 AAAATACTGTGAAAGAACATTGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200760087 Y:7029596-7029618 AAAATACTGTCTAAAGAGGAAGG + Intronic
1201564822 Y:15354900-15354922 AAAAAAATGTAGAAGGATATTGG + Intergenic
1201681213 Y:16645527-16645549 ATAATACTTTAGAAAGAGATTGG + Intergenic