ID: 947567799

View in Genome Browser
Species Human (GRCh38)
Location 2:231205937-231205959
Sequence CAGTCACAGCAGAGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 540}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947567799_947567811 3 Left 947567799 2:231205937-231205959 CCCCCCTCCCTCTGCTGTGACTG 0: 1
1: 0
2: 4
3: 46
4: 540
Right 947567811 2:231205963-231205985 TGGGCCCACCTGGGTAATCCAGG 0: 5
1: 74
2: 354
3: 688
4: 1238
947567799_947567808 -7 Left 947567799 2:231205937-231205959 CCCCCCTCCCTCTGCTGTGACTG 0: 1
1: 0
2: 4
3: 46
4: 540
Right 947567808 2:231205953-231205975 GTGACTGCCTTGGGCCCACCTGG 0: 1
1: 1
2: 11
3: 96
4: 442
947567799_947567809 -6 Left 947567799 2:231205937-231205959 CCCCCCTCCCTCTGCTGTGACTG 0: 1
1: 0
2: 4
3: 46
4: 540
Right 947567809 2:231205954-231205976 TGACTGCCTTGGGCCCACCTGGG 0: 1
1: 0
2: 7
3: 44
4: 226
947567799_947567816 23 Left 947567799 2:231205937-231205959 CCCCCCTCCCTCTGCTGTGACTG 0: 1
1: 0
2: 4
3: 46
4: 540
Right 947567816 2:231205983-231206005 AGGATCATCCCCCAATTTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947567799 Original CRISPR CAGTCACAGCAGAGGGAGGG GGG (reversed) Intronic
900105527 1:979325-979347 TCGTCACGGCAGAGGGAGGGGGG + Exonic
900469693 1:2847633-2847655 CCGGCACTGCAGAGGGAAGGAGG + Intergenic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
900746150 1:4362054-4362076 CAGGCACAGCTGGGGGAGAGGGG + Intergenic
900878542 1:5364006-5364028 CAATCACTGCATAGGGAGGGAGG - Intergenic
900985991 1:6073013-6073035 CAGTCTCAGCAGAGGAGGTGAGG + Intronic
901519055 1:9768874-9768896 AAGCAACAGAAGAGGGAGGGAGG + Intronic
901613008 1:10513930-10513952 CACTCACAGCAGGGGGTGAGCGG - Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902632248 1:17711893-17711915 CAGCCACATGAGAGGGAAGGGGG + Intergenic
902707686 1:18217018-18217040 GACCCACAGCAGGGGGAGGGTGG + Intronic
903061390 1:20671120-20671142 CAGTCACAGCAGTGAGTGGGAGG - Intronic
903355956 1:22747527-22747549 CAGCCACAGGCAAGGGAGGGGGG + Intronic
903393552 1:22982142-22982164 GAGACACTGCAGAAGGAGGGAGG + Intergenic
903564929 1:24258084-24258106 CATTCACAGGACAGGGAGAGGGG - Intergenic
903779380 1:25811583-25811605 CACTCATTGCAGAGGGAGGGCGG - Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904010134 1:27384661-27384683 GAGGCACAGCAGAGGGAGCATGG - Intergenic
904068865 1:27777186-27777208 GAGTCAGGGAAGAGGGAGGGTGG + Intronic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
904938874 1:34151156-34151178 CAAGCACAGCAGAGGGGGAGAGG - Intronic
905042674 1:34973193-34973215 GAGTCAACGCAGAGGGAGGAGGG + Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905795401 1:40813319-40813341 CAGGCACAGTGGAGGCAGGGAGG + Intronic
906703557 1:47877447-47877469 AAGGGACAGAAGAGGGAGGGAGG - Intronic
907412288 1:54291276-54291298 CTGTCACAGCAGAGGAGGTGAGG - Intronic
909036970 1:70604408-70604430 CAGTCAGGGCACAGGGATGGTGG - Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
910191387 1:84599490-84599512 CAGTCACAGCAGGGAGAAAGTGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
911348085 1:96721471-96721493 CAGTCAGGGCAGAGAGAGTGTGG + Intergenic
912313371 1:108645264-108645286 CAGTCACAGGAAAGGAGGGGAGG + Intergenic
912384756 1:109265762-109265784 CAGTCACACAAGAGGCAGGTGGG - Exonic
912960109 1:114188563-114188585 CAGACACAGCAGGGGCAGGCTGG + Intergenic
914804839 1:150984245-150984267 TCCTCACAGCAGAGGGACGGGGG - Intronic
916150803 1:161787488-161787510 GAGTCACAGCAGAGTGAGGAGGG - Intronic
916175086 1:162031408-162031430 GGGTCACAGCAGAGGGAGAGAGG + Intergenic
918002434 1:180510084-180510106 GAGACTCAGCAGGGGGAGGGTGG - Intergenic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
919978163 1:202626241-202626263 ATGCCACTGCAGAGGGAGGGTGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
921275836 1:213519042-213519064 CATTCTCAGCAGATAGAGGGAGG + Intergenic
923125067 1:231027615-231027637 CAGCCACAGCTGAGGAAGAGGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923517169 1:234707550-234707572 CAGTAACAGCATAGGAAGGAAGG + Intergenic
923521349 1:234737449-234737471 CAGTGACAGCAGAGAGGGGTGGG + Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924433189 1:244015035-244015057 CAGTGACGGCAGAGGGAGCCAGG + Intergenic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1065267442 10:23992439-23992461 GAGTAACAGGAGAGGGATGGAGG + Intronic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1067293455 10:44960610-44960632 CTGGCACGGCGGAGGGAGGGAGG + Intronic
1067440535 10:46306955-46306977 CTGTCCCAGCAGGGGGTGGGGGG - Intronic
1067694693 10:48526325-48526347 GAGTTAAAGGAGAGGGAGGGAGG - Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068369257 10:56092151-56092173 CACTCACAGCAGAAGGTGAGGGG - Intergenic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069628295 10:69881453-69881475 GACCCACAGCAGAGGGAGAGGGG + Intronic
1069831913 10:71286896-71286918 CAGACACGGCCAAGGGAGGGAGG + Intronic
1069915600 10:71784862-71784884 CAGTCAGAGAAGGAGGAGGGAGG - Intronic
1070546058 10:77453592-77453614 AAGTCACAGCAGAAAGAAGGAGG + Intronic
1070671015 10:78377292-78377314 CAGTCTCAGCACAGGTGGGGTGG + Intergenic
1072943119 10:99785267-99785289 CACTCACAGTAGAAGGAGGAGGG + Intronic
1072957913 10:99903275-99903297 CAGTCACAACAGTGGGGGTGGGG + Intronic
1073100095 10:101001994-101002016 GAGGCCCAGCAGAGGGAGGCAGG + Exonic
1073248408 10:102107371-102107393 CAGTCACCCCAGAGGAAAGGGGG + Intergenic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1076187523 10:128460893-128460915 CAGGCAGAGCAGAGGTTGGGAGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076593561 10:131609201-131609223 TGGTCACTGCAGATGGAGGGAGG - Intergenic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077386881 11:2273603-2273625 GAGTGACAACAGAGGGATGGGGG + Intergenic
1078607074 11:12786120-12786142 CAGTCACAGCACAGGGTGGGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1080045541 11:27803999-27804021 GGGTCACAGAAGAGGGAGGGAGG + Intergenic
1080508078 11:32937760-32937782 TTGTCACAGCAGAGGGACAGTGG - Intronic
1080653726 11:34242433-34242455 CAGCCACAGGAGGGGCAGGGAGG + Intronic
1081567946 11:44271113-44271135 CAAACACAGCAGAGGCAGGCAGG + Intronic
1081863939 11:46349327-46349349 CAGGCTCCGCAGGGGGAGGGAGG + Intronic
1082786930 11:57322429-57322451 CACTCCCAGCTGCGGGAGGGAGG - Intronic
1083265409 11:61544555-61544577 AGGTCAAGGCAGAGGGAGGGCGG + Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1083768585 11:64854015-64854037 CAGCCACAGCAAAGGCCGGGGGG + Exonic
1083862569 11:65430272-65430294 CAGCCACAGAAAAGGGAGAGGGG - Intergenic
1084176029 11:67422835-67422857 CAGCCACTGAAGAGAGAGGGAGG - Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084630866 11:70348429-70348451 CAGCCACAGCAGGGAAAGGGCGG - Intronic
1084804587 11:71570061-71570083 CAGTCACAACTGAGAGAAGGGGG - Intergenic
1084805868 11:71578567-71578589 CAGTCACAACTGAGAGAAGGGGG + Intergenic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1087340999 11:96907012-96907034 CAATCACACCAGAGGAAAGGTGG - Intergenic
1089218009 11:116847406-116847428 CAGTTACGGAAGATGGAGGGAGG + Intronic
1089616424 11:119697193-119697215 GACTCACAGCCGAGAGAGGGGGG + Intronic
1089693338 11:120200048-120200070 GAGCCAGGGCAGAGGGAGGGAGG + Intergenic
1090022675 11:123141528-123141550 CTGTCACAGCACAAGGAAGGAGG - Intronic
1090080370 11:123608607-123608629 CAGTGACAGCGGAGGGGGAGGGG - Intronic
1090184399 11:124726991-124727013 CAGTCACAGCCTAGTGAGGAAGG + Intergenic
1090678520 11:129028315-129028337 CAGTCACAAGCGAGGGAAGGGGG + Intronic
1091175658 11:133555039-133555061 GAGTCAAAGCACAGGGAGGTTGG + Intergenic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091214482 11:133892297-133892319 CAGCCACAGCAGAGGCGGAGAGG - Intergenic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1092477153 12:8829005-8829027 CAGTCACTGCTGGGGGATGGCGG + Intronic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1095915678 12:47475452-47475474 CAATCTCTGCATAGGGAGGGTGG - Intergenic
1096511511 12:52132238-52132260 CAGTGATTGCACAGGGAGGGGGG + Intergenic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097119233 12:56718916-56718938 GAGTCACAGCTGAGGGAGTAGGG + Intronic
1097187327 12:57202820-57202842 GAGGCACAGCACAGGGATGGGGG - Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1099825186 12:87767265-87767287 CATTCACAAGAGAGAGAGGGAGG + Intergenic
1101399085 12:104372842-104372864 CAGTCCCAGCAGCGCCAGGGTGG + Intergenic
1101800987 12:108021786-108021808 CCTTCAGAGCACAGGGAGGGTGG + Intergenic
1102021310 12:109685233-109685255 CTCTCACATCAGAGGGAGTGAGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103075761 12:117981281-117981303 CAGTCACAGCAGAGGTGGGAGGG - Intergenic
1103920602 12:124397234-124397256 CAGGCACGGCCGAGGGAGGGAGG + Intronic
1104822701 12:131687441-131687463 CAGTCACAGCGCAGGAGGGGAGG - Intergenic
1104943189 12:132404359-132404381 CAGTCACAGCATAGGTGGGAGGG + Intergenic
1105348006 13:19591426-19591448 TAGACACAGCTGATGGAGGGAGG - Intergenic
1107942577 13:45387868-45387890 CAGTCACAGCGAAGGCATGGTGG + Intergenic
1108500786 13:51067974-51067996 CAGTCACAGTATCGGCAGGGAGG - Intergenic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1108795392 13:54024029-54024051 CAGTCACAGTAGAGGGTGGCTGG - Intergenic
1109546309 13:63840775-63840797 CACCCACCGCAGAGGGGGGGAGG + Intergenic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1111785334 13:92779124-92779146 CAATCACAGCAGAAGGAGAAAGG + Intronic
1112078288 13:95936743-95936765 CAGTCTCTGCACAGGCAGGGTGG + Intronic
1112578124 13:100655473-100655495 CAGTAACAGGACTGGGAGGGAGG - Intronic
1112937338 13:104817388-104817410 CATGCACAGCAGGGGAAGGGTGG + Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113835678 13:113326870-113326892 AGGCCACAGCAGCGGGAGGGAGG + Intronic
1114532248 14:23403309-23403331 CAGGGACAGCAGTGGGTGGGGGG + Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121268666 14:92622751-92622773 TGGGCACAGCAGAGAGAGGGAGG + Intronic
1121630052 14:95415290-95415312 AAGTCAGAGCAGTGGCAGGGTGG - Intronic
1122129279 14:99595771-99595793 AAGTTACAGCAGGGGCAGGGTGG - Intronic
1122324411 14:100874143-100874165 GAGTCAAAGCAGTGGGTGGGTGG + Intergenic
1122879014 14:104681742-104681764 CACTCACTGGAGAGGCAGGGTGG + Intergenic
1122955654 14:105069722-105069744 CAGACACACCTGATGGAGGGGGG - Intergenic
1122955673 14:105069792-105069814 CAGACACACCTGATGGAGGGAGG - Intergenic
1123025581 14:105422172-105422194 CAGTCAGAGTAGAGAGGGGGAGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1124624516 15:31300346-31300368 ACGTGACAGCAGAGGGTGGGTGG - Intergenic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1125429250 15:39579852-39579874 GGATCACAGCAGAGGGAGCGAGG + Intergenic
1126200305 15:45978299-45978321 CAGTTCCAGCATAGGAAGGGTGG - Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1127618539 15:60710808-60710830 AGGGCACAGAAGAGGGAGGGAGG + Intronic
1128064447 15:64755685-64755707 CAGCCACACCAGAGTGAGGAGGG + Intronic
1128720400 15:69943517-69943539 GAGGCACAGCAGAGGCGGGGGGG + Intergenic
1129002733 15:72347602-72347624 CAGTCTCTGTAGAGGCAGGGAGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129701158 15:77769385-77769407 CAGTCACAGGGGAGGCTGGGGGG - Intronic
1129868653 15:78927242-78927264 CATGCACAGCTTAGGGAGGGTGG - Intronic
1130563847 15:84979009-84979031 CAGTCACAGGGGTAGGAGGGAGG + Intergenic
1130569432 15:85027520-85027542 AAGTCACAGCAAGGGGAGGAAGG - Intronic
1130937464 15:88482441-88482463 CATTCACAGGAGAGGAAGTGAGG + Intergenic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1131390167 15:92041306-92041328 CAGGCATTGCAGAGGCAGGGAGG + Intronic
1131778268 15:95825987-95826009 CACTCTCATCAGAGGAAGGGAGG + Intergenic
1132222751 15:100117131-100117153 CTGTAACAGCAGAGAGGGGGTGG - Intronic
1132233244 15:100200374-100200396 CAGCCACAGCAGGGGTGGGGAGG + Intronic
1132396453 15:101478513-101478535 AAGCCACAGAAGAGGGAGGGAGG - Intronic
1132743708 16:1428234-1428256 CCGACACAGCTGAGGGACGGCGG - Intergenic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1133192880 16:4147361-4147383 CAGTCACAGTTGTGTGAGGGTGG + Intergenic
1134040002 16:11061039-11061061 GAGTCACAGCAGGGGGCTGGGGG + Intronic
1134075809 16:11290523-11290545 AAGTCACAGAGGTGGGAGGGGGG + Intronic
1134358880 16:13511652-13511674 AAGTTACAGTATAGGGAGGGAGG + Intergenic
1135394306 16:22119288-22119310 CAGTGACAGGATAGAGAGGGTGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136080274 16:27847823-27847845 CAATCACAGCAGAGGGCGAAGGG - Intronic
1137701350 16:50500293-50500315 CAGTGACAACCCAGGGAGGGAGG + Intergenic
1138426014 16:56932429-56932451 CATCCCCAGCAGAGGGCGGGGGG - Intronic
1139466082 16:67154954-67154976 GATTCACTGCAGAGGGAGTGGGG + Exonic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1140967147 16:79977879-79977901 CAGGCACAGCAGAGAGCAGGTGG - Intergenic
1141645174 16:85363578-85363600 CACACACAGCAGAGGAAGGAGGG + Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141949832 16:87333331-87333353 CCGGCACAGCAGAGGCAGGCAGG + Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144930661 17:18856331-18856353 CAGCCACAGCAGAGAGGTGGGGG + Intronic
1145253177 17:21307536-21307558 GGGTCAGAGGAGAGGGAGGGAGG + Intronic
1145323393 17:21780382-21780404 GGGTCAGAGGAGAGGGAGGGAGG - Intergenic
1146307804 17:31743969-31743991 AAGCCACAGCATTGGGAGGGAGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147193442 17:38749811-38749833 CAGCCACACCAGCGGGACGGGGG + Exonic
1147596765 17:41722889-41722911 CACTGGCAGAAGAGGGAGGGAGG + Exonic
1148072750 17:44917631-44917653 GAGTCCCAGCACAGAGAGGGAGG + Intergenic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148754029 17:49963149-49963171 GAGAGACAGCGGAGGGAGGGTGG + Intergenic
1148806101 17:50264721-50264743 CAGTCACAGGGAGGGGAGGGTGG + Intergenic
1151370408 17:73643724-73643746 CAGCCACAGCAGACGGGGGGAGG + Intronic
1151468040 17:74300355-74300377 CAGACATAAGAGAGGGAGGGAGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152072747 17:78142055-78142077 CAGACACAGCCTTGGGAGGGGGG - Exonic
1152428016 17:80229140-80229162 CAGCCACAGAAGAGAGAGGGTGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152850638 17:82632630-82632652 CAGACACAGAAGTGGGTGGGTGG - Intronic
1152866397 17:82726338-82726360 CAGTCACAGGAGCCTGAGGGGGG - Intronic
1153026783 18:679770-679792 CAGTCACAGTAGAGGATGGATGG - Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1156654765 18:39272137-39272159 TAGTGACAGCAAAGGGAGGCAGG - Intergenic
1157103748 18:44753768-44753790 CAGTGACAGCAGGGTGAGGGAGG + Intronic
1157401270 18:47390514-47390536 CAGCCACAGCAGGGAGAAGGAGG + Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1157514801 18:48303317-48303339 GAGTCTCATCAGAGGGAGGTTGG - Intronic
1157570658 18:48710058-48710080 CAGTCCCAGCATAGCCAGGGTGG + Intronic
1157882024 18:51329663-51329685 TATTCACAGAGGAGGGAGGGAGG + Intergenic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
1160527437 18:79545867-79545889 TAGTGACAGCAAAGGGAGGCAGG + Intergenic
1160901088 19:1429079-1429101 CATGCACAGCAGAGGTGGGGAGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161084757 19:2329683-2329705 CAGCCACAGCAGAGGGATAGCGG - Intronic
1163670862 19:18627682-18627704 CCGCCAGAGCAGAGGGAGTGAGG - Intergenic
1164453687 19:28388880-28388902 CAGTCATGGCAGAGGGAAAGGGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164558285 19:29269932-29269954 CAGCCACAGCGGGGGGGGGGGGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165311447 19:35031163-35031185 CACCCACAGCCGCGGGAGGGGGG + Intronic
1166089898 19:40502105-40502127 CTGACACAGCAGAGGAAGGGGGG - Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167671968 19:50858740-50858762 GAGTCAAAGAAGAGGGAAGGAGG - Intronic
1167948440 19:53008046-53008068 CAGTCACTGCACAGCCAGGGTGG - Intergenic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
1168150477 19:54444817-54444839 CAGTCAGCGCAGAAGGTGGGAGG + Intergenic
925742541 2:7018535-7018557 CAGTCACAGCAAAGCAAGGAGGG - Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926645772 2:15288398-15288420 CACACCCAGCAGAGGGTGGGAGG + Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928119540 2:28573653-28573675 AAGGCACAGCTGAGGAAGGGAGG - Intronic
928203144 2:29264171-29264193 GAGACACAGCAGAGGGTGGGTGG - Intronic
928224073 2:29432378-29432400 CAGTCATAGCAGAAGGGGCGGGG - Intronic
928265694 2:29809680-29809702 CAGTCACAGCATAGGTTTGGTGG + Intronic
929603554 2:43219822-43219844 CTGGCACGGCTGAGGGAGGGAGG - Intergenic
929655949 2:43731899-43731921 CAGGCACAGCAATGGGAGAGGGG + Intronic
929712508 2:44279340-44279362 CAGGCACAGCAAAGGAAAGGAGG - Intronic
929800735 2:45099172-45099194 CAGTTACTGAAGAGGGATGGAGG - Intergenic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930768771 2:55111588-55111610 GACTCCCAGCAGAGGGTGGGAGG - Intronic
931510999 2:62994095-62994117 CATTCAAAGCAGAGTGAGAGGGG + Intronic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
933819291 2:86095086-86095108 CAGCCAGAGCAGAGTGAGAGGGG - Intronic
935579730 2:104746144-104746166 CAGTCACAGCCGAGGGGTGGGGG - Intergenic
936055775 2:109260897-109260919 CTCTCACAGCAGAGGCAGGATGG - Intronic
936518705 2:113198662-113198684 CAGCCACAGGAGGGGGCGGGAGG + Intronic
936574767 2:113643896-113643918 CATTCTCAGAAGAGTGAGGGGGG + Intergenic
937292164 2:120788272-120788294 CAGTCACAGCACAAAGAGGTTGG + Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937436850 2:121888081-121888103 CAGTCACAGCAGCCAGAGGCTGG - Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
938866239 2:135423660-135423682 CAGTCACAGTGGAGGGTAGGGGG + Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
942127177 2:172838805-172838827 CAGTCACAGGGGAGGATGGGAGG + Intronic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
946009047 2:216550133-216550155 CATCCACAAAAGAGGGAGGGTGG - Intronic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947907446 2:233775670-233775692 CAGCCACAGCAATGGGATGGTGG - Exonic
947909735 2:233793200-233793222 CATTCACAGGAGAGGGAGACCGG + Intronic
948055404 2:235006608-235006630 CTGGCAAAGCAGAGCGAGGGGGG - Intronic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
948371931 2:237495139-237495161 GAGGCACAGGTGAGGGAGGGAGG - Intronic
948594592 2:239071595-239071617 CAGTCACAGCAGTAGCAGGCTGG - Intronic
948667708 2:239546625-239546647 CACTCGCAACAGAGGGCGGGTGG - Intergenic
948838298 2:240636793-240636815 CAGGAACAGAAGGGGGAGGGTGG - Intergenic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169195331 20:3679625-3679647 GGGACAAAGCAGAGGGAGGGGGG + Intronic
1169247912 20:4038355-4038377 CAGTCAGCCCAGAGGGCGGGTGG + Intergenic
1170834936 20:19876017-19876039 CATTAACAGAAGAGGGAGCGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1174033872 20:47653612-47653634 GATACACAGCAGAAGGAGGGGGG - Exonic
1175414003 20:58789573-58789595 CAGTCACAGCTGTGGGGAGGGGG + Intergenic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1175950592 20:62581282-62581304 CAGTCCCAGCATGGGGTGGGGGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176087239 20:63303734-63303756 CACTCACTGCACAGGGAGGATGG + Intronic
1176213092 20:63934939-63934961 GAGTCAGAGCTAAGGGAGGGTGG - Exonic
1176703741 21:10093193-10093215 AACTCAAAGCAGAGGGAGTGGGG + Intergenic
1178267911 21:31161381-31161403 CAGTCACAGGAGAGAGGAGGCGG + Intronic
1178590328 21:33904278-33904300 CACACAGAGCAGAGGCAGGGAGG - Intronic
1178829522 21:36044233-36044255 CACTCACAGCCCAGGGAAGGAGG + Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179376396 21:40853306-40853328 CAGTGATGGCAGTGGGAGGGTGG - Intergenic
1179713353 21:43275413-43275435 CAAGCAGAGCAGATGGAGGGAGG - Intergenic
1179789799 21:43749757-43749779 CCACCACAGCAGAGGGAGGGTGG + Intronic
1179822111 21:43942988-43943010 TTTCCACAGCAGAGGGAGGGAGG + Intronic
1180955673 22:19740153-19740175 CAGCCACAGCAGAGGCCTGGAGG - Intergenic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1181851221 22:25751331-25751353 TAGTCACAGCACAGGGCGTGTGG - Intronic
1182009207 22:26986295-26986317 CAGCCACAGCCGCGGGAGGAAGG + Intergenic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182111041 22:27723898-27723920 CAGTCACAGCAGTCAGAGAGTGG + Intergenic
1182421173 22:30249241-30249263 CACACACAGCATAGAGAGGGAGG - Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1184111532 22:42398314-42398336 CAGTGACAGCAGAGGAAGACTGG - Intronic
1184278948 22:43426374-43426396 AGGTGACAGCACAGGGAGGGGGG + Intronic
1184288093 22:43483321-43483343 CAGTGACAGCTGGGGGAGTGGGG - Intronic
1184534193 22:45075623-45075645 CCCTCCCAGCAGAGTGAGGGAGG - Intergenic
1185156338 22:49195576-49195598 CAGTCTCAGCAGAGCCCGGGTGG + Intergenic
1185425406 22:50766980-50767002 CATTCTCAGAAGAGTGAGGGGGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949618918 3:5788036-5788058 AAATAACTGCAGAGGGAGGGAGG - Intergenic
950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG + Intergenic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
952333517 3:32385806-32385828 GAGGCCCAGCAGAGGGAGAGCGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952920834 3:38282740-38282762 CGGTCCCTGCAGAGGGAGGCTGG + Intronic
953553118 3:43920075-43920097 CAATCACTGCTGAGGCAGGGAGG + Intergenic
954117571 3:48475660-48475682 GAGTCACAGCAGAGGGTCAGTGG + Intronic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954898378 3:53996860-53996882 CAGTCACTGCTGAGGGACGCTGG - Intergenic
954907591 3:54076184-54076206 TGGGCACAGCAGAGAGAGGGAGG - Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955084641 3:55690919-55690941 GAGCTACAGGAGAGGGAGGGAGG - Intronic
955327627 3:58021369-58021391 CCCTCTCAGCAGAGGCAGGGAGG + Intronic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955800333 3:62679725-62679747 TAGTCACAGAAGAGGCAGGGAGG + Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956893938 3:73640697-73640719 AAGCCACATCAGAGTGAGGGTGG + Intergenic
957053249 3:75426238-75426260 GCGGCTCAGCAGAGGGAGGGAGG - Intergenic
959057322 3:101581100-101581122 CAAACAGAGCAGAGTGAGGGTGG - Intronic
960121709 3:113953891-113953913 CAGTGCCAGCACAGGAAGGGAGG - Exonic
961479166 3:127168453-127168475 CTGCCAGAGCTGAGGGAGGGAGG + Intergenic
961630469 3:128294936-128294958 CAGGCACAGCAGAGGCCTGGAGG - Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962268186 3:133958329-133958351 CAAGCACAGCAGAGGGTGAGAGG + Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962599382 3:136979450-136979472 CTGTAACAGCAAAGGGAGGCAGG + Intronic
962783529 3:138744521-138744543 CAGACACAGAAGAGTGAAGGAGG + Intronic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963757168 3:149247082-149247104 CAGGTACAGCGGTGGGAGGGAGG + Intergenic
965426244 3:168527363-168527385 CAGTCAGAGCATAAGGTGGGTGG - Intergenic
966164236 3:176999074-176999096 CTGGCACAGCAGAGAGAGGAGGG + Intergenic
966632843 3:182097630-182097652 CAGACACAGCAAGGAGAGGGTGG + Intergenic
966835851 3:184048940-184048962 CAGTCAGAACAGGGGGTGGGAGG + Intergenic
967210707 3:187165955-187165977 TGGTAACAGCAGAGTGAGGGAGG + Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
968350930 3:198051366-198051388 CAGCCAAGGCAGAGAGAGGGGGG - Intergenic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969285020 4:6197725-6197747 CAGTCACAGCTAAGTGAGGCAGG + Intronic
969617445 4:8261995-8262017 GAGCCACAGCAGATGGAGGGGGG + Intergenic
970431206 4:15990617-15990639 CACTCAGAGCAGAGGGTGGAAGG + Intronic
970525472 4:16927709-16927731 CAGTCAAAGGAGAGAGAGTGGGG - Intergenic
970601137 4:17641978-17642000 CAGCCGCAGTAGGGGGAGGGGGG + Intronic
971316409 4:25571780-25571802 CATCCACAGCAGAGAAAGGGGGG - Intergenic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
973687999 4:53393776-53393798 CATTCACAGCCGGGGGCGGGGGG - Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974600089 4:64067957-64067979 CAATCACAGAATAGTGAGGGAGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976096450 4:81513315-81513337 GAGCTATAGCAGAGGGAGGGAGG - Intronic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
978112248 4:104977160-104977182 CAGTCACAGCCATGGGAGGCAGG + Intergenic
978376477 4:108079461-108079483 CAATCACAGCAGAGCCCGGGTGG + Intronic
980375957 4:131949545-131949567 AACTCAAAGCAGAGGGAGTGGGG + Intergenic
981018210 4:139997454-139997476 CAGTAACAGCACAAAGAGGGTGG - Intronic
981145024 4:141313913-141313935 CAGCTACAGCAGAGCCAGGGAGG - Intergenic
982680294 4:158419830-158419852 CAGACAGAGCAGTGTGAGGGGGG - Intronic
984103318 4:175513977-175513999 CAGTCACAGCAGAAGGTGAAGGG - Intergenic
984171764 4:176368247-176368269 CAATCTCTGCAGAGGAAGGGTGG + Intergenic
984875635 4:184365082-184365104 CTGTCACAGAAGTGGGAGTGGGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985560041 5:580639-580661 AAGTCACAGCAGAAGGCGAGAGG + Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986006158 5:3670786-3670808 AAGCCACAGGAGAGGAAGGGAGG - Intergenic
986480561 5:8182862-8182884 CAATCACAGCAGAATGATGGAGG - Intergenic
991023698 5:62007677-62007699 TGGTCACAGCTGAGTGAGGGTGG - Intergenic
995062287 5:107823781-107823803 CAATCACAGCAGAAGGAGAAGGG - Intergenic
995553213 5:113300698-113300720 GAGTCACAGCGGTGGGAGAGTGG - Intronic
996400689 5:123059038-123059060 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
996777392 5:127147428-127147450 CAGGCACAGGAGAGAGAGAGGGG + Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001251619 5:170151453-170151475 CAGTCACCCCTGGGGGAGGGCGG + Intergenic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1002024748 5:176389215-176389237 GGATCACAGCGGAGGGAGGGCGG - Intronic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002759755 6:192302-192324 CAGTGACAGCAGAGCAAGCGTGG + Intergenic
1002853812 6:1020426-1020448 GAGACACAGCTGAGGGAGGCAGG + Intergenic
1005426259 6:25705886-25705908 AAGTCACTGCAGAGAGAGGAGGG - Intergenic
1005919713 6:30389954-30389976 CAGTCACCCAAGAGGGAAGGTGG - Intergenic
1006507308 6:34497682-34497704 CAGCCCCAGCAGAGCGTGGGAGG - Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007833209 6:44654640-44654662 CAGGCAGAGCAGCGGCAGGGAGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008547380 6:52595348-52595370 CAGGCACAGCTTAGGGAGAGAGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1011856033 6:91692691-91692713 TGGTCACAGCAGACAGAGGGTGG + Intergenic
1011957207 6:93037744-93037766 CAGTCTCTGCACAGGAAGGGTGG + Intergenic
1012353341 6:98280734-98280756 CACTCACAGCTGATGGGGGGTGG + Intergenic
1012987756 6:105893135-105893157 CAGTCAAAGCAGACAGAGGGAGG + Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1013793024 6:113857607-113857629 CACACACACCGGAGGGAGGGGGG - Exonic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1016061706 6:139637286-139637308 CAGTCACTGCTGTGGGATGGGGG + Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1017772890 6:157656747-157656769 CAGTCACAGCAGAGAACAGGAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1018581096 6:165308968-165308990 CAGTCCCAGCACATGGCGGGTGG + Intronic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019044289 6:169131357-169131379 CAGTCACAGCAGAGAATGGTGGG + Intergenic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019698209 7:2459744-2459766 CAGTCTCTGCAATGGGAGGGTGG + Intergenic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1021170398 7:17392263-17392285 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1022390626 7:29940866-29940888 CACTCTCTGCAGAGGGAGTGAGG - Exonic
1022653410 7:32297560-32297582 CAGTCACAGCATGGGGCGGAAGG + Intronic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023175608 7:37432733-37432755 CAGGCACTGGGGAGGGAGGGAGG + Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1023638085 7:42233118-42233140 CAGTCACTCCAGGGAGAGGGAGG - Intronic
1023872279 7:44269539-44269561 GACTCACAGCAGGGGGTGGGGGG + Intronic
1024708436 7:51987043-51987065 CAGTCATAGCAGCGCGATGGGGG - Intergenic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1027695582 7:81405603-81405625 CAGTCATGGCAGAGGGTGAGGGG + Intergenic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028205550 7:88012793-88012815 TAGTCTCAGCAAAGGGAGTGAGG - Intronic
1029085346 7:98007028-98007050 ATGGCACAGGAGAGGGAGGGGGG - Intergenic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1030656051 7:112169188-112169210 CAGTCACAGCAGAAGGTGAAGGG - Intronic
1030754176 7:113268557-113268579 CAGTCTCTGCACAGGAAGGGTGG - Intergenic
1031122523 7:117738082-117738104 CAGTCACAGCTGCGGAAGGCAGG + Intronic
1031887253 7:127254710-127254732 CAACCACAAAAGAGGGAGGGAGG + Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032689177 7:134265677-134265699 CTGTCCCAGCAGAGAGAAGGAGG - Intergenic
1033176831 7:139132518-139132540 CAGTCACATCCCAGGGAGGAGGG - Intergenic
1033220321 7:139523361-139523383 GAGCCACAGCAGAGGGTGGTAGG - Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033586095 7:142775452-142775474 TGGACACAGCAGAGGGAGGCAGG + Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1034852060 7:154502576-154502598 CAGTCACAGCAGAAGGTGAAAGG - Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035265114 7:157685899-157685921 CTGTCCCAGCAGAGGAGGGGTGG + Intronic
1035280127 7:157773160-157773182 CACTCGCAGCAGACGGAGGCAGG + Intronic
1035545268 8:476947-476969 CAGTCAAAGCAGTGGTAGGAGGG - Intergenic
1036607364 8:10319322-10319344 CAGTCTCAGCAGCTGAAGGGTGG - Intronic
1036767468 8:11557883-11557905 CACTCACACCAGAGAGAGGCTGG + Intronic
1037088633 8:14884923-14884945 AAGTCACAGCTGAGAGAGAGGGG - Intronic
1037516632 8:19638266-19638288 CAGACACAGTTGAGGCAGGGAGG - Intronic
1037787572 8:21911887-21911909 CAGTCACAGGTGAGGGGGCGGGG - Exonic
1039921451 8:41896771-41896793 CCGCCGCAGGAGAGGGAGGGAGG - Intergenic
1040468454 8:47716692-47716714 CACTGACTGCAGAGGGTGGGTGG + Intronic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1041912473 8:63103495-63103517 CAGGCACAGAAGAGAGAGGTGGG + Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1043780273 8:84325351-84325373 CAGTCATAGCAGAGGGTGTTAGG - Intronic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044767860 8:95596290-95596312 GAGGCACAGCAAAGGTAGGGTGG + Intergenic
1045318468 8:101063408-101063430 CAGTCACAGTACAGGGTGGCTGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046942187 8:119942044-119942066 ATGTTACAGCAGGGGGAGGGGGG - Intronic
1047105196 8:121724305-121724327 CAGACACAGCTGAGGTGGGGTGG - Intergenic
1047705905 8:127499408-127499430 CAGTCACAGCTGTGGGAATGAGG + Intergenic
1047889186 8:129288461-129288483 AAGACTCAGAAGAGGGAGGGTGG + Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1048940694 8:139398099-139398121 CAGCCACAGAGTAGGGAGGGAGG - Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049378238 8:142299183-142299205 TTGCCACAGCAGAGGCAGGGAGG + Intronic
1049469658 8:142769668-142769690 CAGTCACAGCCCAGGGCTGGAGG + Intronic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1051780005 9:20679928-20679950 GAGAAACAGCAGAGAGAGGGTGG - Intronic
1052267930 9:26595672-26595694 CAGCCACAGGGGAGGGAGAGAGG + Intergenic
1052758720 9:32567799-32567821 CAGTCCAAGGAGAGGGAGAGAGG - Exonic
1052966575 9:34345011-34345033 AAGTCACAACAGAGAGAGGAGGG + Intergenic
1052973904 9:34398353-34398375 CAGCCACAGCTGAGAGAGGAGGG + Exonic
1053641007 9:40080213-40080235 AACTCAAAGCAGAGGGAGTGGGG + Intergenic
1053765129 9:41385255-41385277 AACTCAAAGCAGAGGGAGTGGGG - Intergenic
1054321751 9:63676509-63676531 AACTCAAAGCAGAGGGAGTGGGG + Intergenic
1054543745 9:66296417-66296439 AACTCAAAGCAGAGGGAGTGGGG - Intergenic
1054798685 9:69325587-69325609 AAGTGACAGCAGCGGGCGGGCGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1057016587 9:91657682-91657704 CAGTCCCAGCAGAGGGGATGGGG - Intronic
1057176059 9:93000225-93000247 CAATCAGAGCAGGGAGAGGGAGG - Intronic
1057755546 9:97832040-97832062 CACTCACAGCAGGGGCCGGGAGG + Intergenic
1057978875 9:99637770-99637792 CAATCACAGAAGTGGGAGAGTGG + Intergenic
1059281504 9:113138009-113138031 GTGGTACAGCAGAGGGAGGGAGG - Intergenic
1059386920 9:113971789-113971811 CAGTCAGAGGAGGGGTAGGGTGG + Intronic
1059561669 9:115340573-115340595 CAGTAACAGCAGGGGGACAGGGG + Intronic
1059739209 9:117133287-117133309 CAGTCACCTCACAGGGAGGCTGG - Intronic
1060418498 9:123450239-123450261 CAGACACAGCATAGGGGGTGGGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060657352 9:125381059-125381081 CTGTCACAGCAGAGGGTCTGTGG + Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1061612398 9:131755828-131755850 CATTCACAGCAGCCGGAGCGAGG - Intergenic
1061802472 9:133120090-133120112 CAGGCAGAGCAGGGCGAGGGGGG + Intronic
1061817635 9:133206269-133206291 CAGACACAGCAGAGGGACACAGG + Intronic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1062536668 9:137024100-137024122 CAGGCACAGCCGGGGGAGCGCGG - Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1202788778 9_KI270719v1_random:63288-63310 AACTCAAAGCAGAGGGAGTGGGG + Intergenic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1186828558 X:13366331-13366353 AAGTCAGAGGAGAGGCAGGGAGG + Intergenic
1187389781 X:18878365-18878387 CACTCATAGCAGAGGCAGAGTGG - Intergenic
1187584076 X:20640527-20640549 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1188217852 X:27501259-27501281 CACACACAGCAGAGGAGGGGAGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189824501 X:44903532-44903554 AAGTCACAGAAGAAGGAGAGGGG - Intronic
1192172928 X:68867940-68867962 CAGTGACAGCAGGGAGTGGGAGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193397635 X:81003986-81004008 CAGTCACCGAGGTGGGAGGGGGG + Intergenic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1195025060 X:100868512-100868534 CAAAAACAGAAGAGGGAGGGAGG - Intronic
1196465622 X:115969088-115969110 GAGACACAGAAGATGGAGGGAGG - Intergenic
1196858437 X:120005312-120005334 TAGAAAGAGCAGAGGGAGGGGGG - Intergenic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1197415499 X:126167095-126167117 CCGTCCCAGGAGAGAGAGGGAGG - Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1199834812 X:151578727-151578749 CACTCAGAGGAGAGGGAGAGGGG - Intronic
1200085772 X:153604063-153604085 CAGCCACAGGAAAGGGTGGGGGG - Intergenic
1200184378 X:154172597-154172619 CAATCACATGACAGGGAGGGAGG - Intergenic
1200190030 X:154209730-154209752 CAATCACATGACAGGGAGGGAGG - Intergenic
1200195783 X:154247539-154247561 CAATCACATGACAGGGAGGGAGG - Intergenic
1200201437 X:154284655-154284677 CAATCACATGACAGGGAGGGAGG - Intronic
1201649591 Y:16270690-16270712 CAATCACAGCAGAAGGAGAAAGG - Intergenic
1201707598 Y:16954363-16954385 CAGCCAAGGCAGAGAGAGGGAGG - Intergenic