ID: 947567942

View in Genome Browser
Species Human (GRCh38)
Location 2:231207264-231207286
Sequence TCCCAAAGTTGTGGGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613137
Summary {0: 3, 1: 265, 2: 15165, 3: 337369, 4: 260335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947567934_947567942 26 Left 947567934 2:231207215-231207237 CCAAGCTGGTCTTGAACTCTTGG 0: 90
1: 2797
2: 28077
3: 103193
4: 172128
Right 947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG 0: 3
1: 265
2: 15165
3: 337369
4: 260335
947567936_947567942 -8 Left 947567936 2:231207249-231207271 CCTCCTGCCTCAGCCTCCCAAAG 0: 25296
1: 77323
2: 157079
3: 168016
4: 148902
Right 947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG 0: 3
1: 265
2: 15165
3: 337369
4: 260335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947567942 Original CRISPR TCCCAAAGTTGTGGGATTGC AGG Intronic
Too many off-targets to display for this crispr