ID: 947573944

View in Genome Browser
Species Human (GRCh38)
Location 2:231257615-231257637
Sequence CCAGTCACAGGGAGGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947573944_947573953 30 Left 947573944 2:231257615-231257637 CCTGCTACCCTCCCTGTGACTGG 0: 1
1: 0
2: 0
3: 23
4: 263
Right 947573953 2:231257668-231257690 GTTTCCTCACTTACAAAATGAGG 0: 3
1: 26
2: 234
3: 1328
4: 4746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947573944 Original CRISPR CCAGTCACAGGGAGGGTAGC AGG (reversed) Intronic
900154801 1:1199620-1199642 CGCGCCACAGGGAGGGGAGCTGG - Intergenic
900313883 1:2047756-2047778 CCAGTCCCAGCGAGGGAAGGTGG - Intergenic
901366956 1:8760532-8760554 GAGGTCACAGGGAGGGTAGCAGG + Intronic
901800249 1:11704315-11704337 CCAGTCACAAGGAGAGCAGGGGG + Intronic
901806931 1:11744467-11744489 GCGGGCAAAGGGAGGGTAGCTGG - Intronic
903022087 1:20401619-20401641 TCAGTCCCAGGGTGGGCAGCTGG + Intergenic
905313251 1:37065193-37065215 CCAGGCTCAGGGAGGGGAGTGGG - Intergenic
907565536 1:55430360-55430382 CCAGTCACAGTGAGATGAGCTGG - Intergenic
909039080 1:70628674-70628696 CCAGGCACAGGTAGGGTGCCTGG + Intergenic
911839042 1:102659037-102659059 ACACTCACAGGGAGGGTGGGCGG - Intergenic
912395734 1:109342080-109342102 CCTGTCCCACGGAGGGGAGCTGG + Exonic
912696805 1:111848197-111848219 GCAGTCACGGGGAAGGGAGCTGG + Intronic
914422353 1:147541246-147541268 CCAGTGACAGGCAGGCTCGCAGG - Intergenic
914675369 1:149904007-149904029 CCCCTCACAGGGAGGGGAGCAGG - Exonic
915524632 1:156468147-156468169 CCAGGCTCAGGGCGGGCAGCTGG + Exonic
915545637 1:156595867-156595889 CAAGTCAAAGCGAGGGTATCGGG + Intronic
915833563 1:159154398-159154420 CCTGTCAGAGGGTGGGGAGCTGG - Intergenic
920985499 1:210885209-210885231 CCAGTCACAGTGAGATGAGCCGG - Intronic
923313622 1:232758708-232758730 CCAAACACAGGGAGAGTAACAGG - Intergenic
924783862 1:247176627-247176649 GGAGGCACAGGGAGGGTAGGAGG + Intergenic
1062877454 10:954457-954479 GCAGAGCCAGGGAGGGTAGCTGG + Intergenic
1063123696 10:3122666-3122688 CCAGTCACAGAGGGTGTGGCCGG - Intronic
1063291670 10:4756097-4756119 CCTGTCGCAGGGTGGGGAGCTGG - Intergenic
1065419143 10:25522283-25522305 CCAAGCACTGGGAGGGTAACGGG - Intronic
1065814970 10:29475030-29475052 GCAGTCACAGGGAGGTTACAGGG + Intronic
1066997558 10:42578012-42578034 CTAGTCACAGAGAGGATAGCCGG + Intronic
1067038475 10:42935626-42935648 CCAGTCACAGGGGGCGTGCCGGG - Intergenic
1067203361 10:44193956-44193978 ACAGTCCCAGGGAGGGCAGGTGG - Intergenic
1068943454 10:62704484-62704506 CCTGTCAGAGGGTGGGGAGCTGG + Intergenic
1069869653 10:71525526-71525548 CCAGGACTAGGGAGGGTAGCTGG + Intronic
1070307341 10:75247564-75247586 CCAGTCAAAGGGAGGCAAGCAGG - Intergenic
1070730868 10:78827311-78827333 CCAGTGTCTGGGAGGGAAGCTGG + Intergenic
1073289136 10:102404826-102404848 CCAGGGACAGGGAGGGGAGCAGG + Intronic
1073537828 10:104293935-104293957 CCAGTCCCAGGGAGGTTAACGGG - Intronic
1077309481 11:1882041-1882063 CCATTCCCACGGAGGGGAGCAGG + Intronic
1078927823 11:15890345-15890367 ACATTCACAGTGAGGGTGGCTGG - Intergenic
1081707182 11:45189436-45189458 GCAGCCACTGGGAGAGTAGCTGG + Intronic
1082609480 11:55280689-55280711 CCAGGCTCAGGGAGTGTGGCAGG + Intergenic
1082761483 11:57131061-57131083 AAAGTCACAGGGAGGGTAGTGGG - Intergenic
1083063457 11:59898548-59898570 ACAGTTCCAGGGAGGGAAGCTGG + Intergenic
1083961115 11:66015564-66015586 GCAGGCACAGGGTGGGTGGCAGG + Intergenic
1084123885 11:67085988-67086010 TCAGTGACAGGGCTGGTAGCAGG - Intergenic
1084381970 11:68818301-68818323 ACAGTCTCAGGGAGGGAAGGAGG + Intronic
1085033877 11:73288760-73288782 CCAGGCTCAGAGAGGGTAGGTGG + Intronic
1088723530 11:112614873-112614895 CCTGTCAGAGGGAGGGTTGATGG + Intergenic
1088723767 11:112617100-112617122 CCTGTCAGAGGGAGGGTTGATGG + Intergenic
1089136334 11:116252244-116252266 CCAGCCAAAGGAAAGGTAGCAGG + Intergenic
1089759139 11:120710326-120710348 CGAGTCACCGGGAGGTTAGGAGG + Intronic
1091746242 12:2994933-2994955 CCTGCCACAGGGCGGGTAGATGG - Exonic
1094222515 12:28009487-28009509 CCAGGGAGAGGGAGGGTGGCAGG + Intergenic
1095267947 12:40181763-40181785 TCAGTCACAGGCAGGGTTACTGG + Intergenic
1096503651 12:52080179-52080201 CAGGTGAGAGGGAGGGTAGCAGG + Intergenic
1096750999 12:53758822-53758844 CCAGACTGAGGGAGGGAAGCGGG - Intergenic
1100302847 12:93324070-93324092 GCAGTCACAGGGAGGTTATGGGG - Intergenic
1100407729 12:94285763-94285785 CCAGACACAGGGAGAGGTGCTGG - Intronic
1102218572 12:111179146-111179168 CCCCTCACAGGGAGCCTAGCAGG + Intronic
1104485842 12:129150711-129150733 TCAGTCACAGAGAGGCTGGCAGG + Intronic
1104610832 12:130226340-130226362 CCAGGCAGAGGGTGGGTTGCAGG - Intergenic
1106257156 13:28032152-28032174 CCAGTCACAGAGAGGACTGCTGG + Intronic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1107567222 13:41617637-41617659 CCTGTCACAGGGCGGGGGGCTGG - Intronic
1108757252 13:53518703-53518725 CCAGTCACAGAGAAGTTAGGGGG + Intergenic
1109514064 13:63418032-63418054 CCTGTCACAGGGTGGGGAGAGGG + Intergenic
1110696496 13:78497140-78497162 CCAGTGAAAGCCAGGGTAGCTGG - Intergenic
1112955796 13:105056675-105056697 AGAGTCACAGGGAGGGTGGAGGG + Intergenic
1113014361 13:105810973-105810995 ACAGTTACAGGAAGGGAAGCTGG - Intergenic
1113061781 13:106330188-106330210 CCAGTCACAGGGAGGCAAACAGG + Intergenic
1114604913 14:23988748-23988770 CCAGTCAGGCGGAAGGTAGCTGG + Intronic
1114610363 14:24036295-24036317 CCAGTCAGGCGGAAGGTAGCTGG + Intergenic
1119662589 14:76462516-76462538 CCAGACACAGAGAGGGTTGCCGG - Intronic
1119987056 14:79149849-79149871 CCAGTCATGGGGAGGGGAGGAGG + Intronic
1120138016 14:80893318-80893340 CCAGGGACAGAGAGGGTAGAGGG + Intronic
1121453291 14:94022987-94023009 CCAGTCCCAGGGAGCAGAGCTGG - Intergenic
1122348875 14:101076526-101076548 CCGGACACAGGCAGGGTAGGTGG - Intergenic
1125564803 15:40668658-40668680 CCAGTGACTGGGAGGGTAATGGG - Intergenic
1128407350 15:67356274-67356296 CAAGTCACAGGGAAGCTTGCCGG + Intronic
1129249189 15:74299253-74299275 CCAGCAAGAGGGAGGGTAGAGGG - Intronic
1129269861 15:74413870-74413892 CCAGTCTCAAGGAAGGCAGCTGG + Intronic
1130148250 15:81292005-81292027 CCTGTGGCAGGGAGGGGAGCAGG + Intronic
1131016724 15:89063838-89063860 CCACGGACAGGGTGGGTAGCGGG + Intergenic
1131021038 15:89099035-89099057 CCTGGCACAGGGAGGGTCCCTGG + Intronic
1132278596 15:100592428-100592450 CCAGTCTCAGGAAGGGGAGAGGG - Intronic
1132659914 16:1056732-1056754 GCTGTCAGAGGGAGGGGAGCTGG + Intergenic
1133235513 16:4385697-4385719 CCAGCCACAGTGAGAGGAGCAGG - Intronic
1137670333 16:50274770-50274792 CCAGTCACAGAGAGGTCAGTGGG - Intronic
1138030619 16:53556835-53556857 GGAGTCACAGGGTGGGGAGCTGG + Intergenic
1138123862 16:54422795-54422817 CCAGTGTCAGGGAGGCCAGCTGG + Intergenic
1138198342 16:55070830-55070852 CAAGTCACAAGGATGGCAGCAGG + Intergenic
1141325314 16:83051728-83051750 AGAGTTACAGGGATGGTAGCAGG - Intronic
1141751704 16:85962599-85962621 CCAGTCACAGGGCAGGAAGCAGG - Intergenic
1142199561 16:88754598-88754620 ACTGTCACAGGGAGGGCTGCCGG + Intronic
1144637933 17:16922950-16922972 GCAGTCAAAGAGAGGGTGGCAGG + Intergenic
1144729352 17:17517771-17517793 CCACTCACAGGCTGGGCAGCAGG - Intronic
1144944176 17:18961402-18961424 CCAGGCACAGGGAGGCTCGGAGG - Intronic
1146176325 17:30668258-30668280 CCAGTCAGAGGGAGGAGGGCGGG + Intergenic
1146260289 17:31416313-31416335 CCCTTCACATGGAGGGGAGCGGG + Intronic
1146349785 17:32084372-32084394 CCAGTCAGAGGGAGGAGGGCGGG + Intergenic
1146682869 17:34821150-34821172 CCAGACACAGGGAAGGGAGAGGG - Intergenic
1150545680 17:66155190-66155212 CCAGTCCCAGTGAGATTAGCCGG - Intronic
1150665197 17:67128099-67128121 CCAGTCAGAGGGAGTGGAGCAGG - Intronic
1151161762 17:72171988-72172010 GGAGTGACAGGAAGGGTAGCTGG + Intergenic
1152134590 17:78496444-78496466 CCAGTCACAGCGGGGGTGGTGGG + Intronic
1152190289 17:78883878-78883900 CCAGGGAAAGGGAGGGCAGCGGG - Intronic
1152218808 17:79049599-79049621 CCAGGCCCAGAGAGGGAAGCAGG - Exonic
1152498582 17:80693212-80693234 ACAGTCACAGGATGTGTAGCAGG + Intronic
1152761864 17:82112689-82112711 GCCGGCACAGGGAGGGAAGCAGG - Intronic
1154161594 18:11984306-11984328 CCCGTCACAGTGTGGGTGGCTGG - Intronic
1156492753 18:37505995-37506017 CCAGGCCCAGGGAGAGTAGTGGG + Intronic
1156561484 18:38130412-38130434 CCAGTAAGAGGGAAGGAAGCAGG - Intergenic
1159487404 18:69081571-69081593 ACAGTCATAGGTATGGTAGCAGG - Intergenic
1160158877 18:76455975-76455997 CCAGTCTCTGGGAGGGGAACAGG - Intronic
1160836481 19:1127028-1127050 CCTGTCCCAGGGTGGGGAGCTGG - Intronic
1160938771 19:1610294-1610316 CCACACAGAGGGAGGGCAGCAGG + Exonic
1161108221 19:2455124-2455146 CCAGGCCCAGGGTGGGTAGGGGG - Intronic
1161159726 19:2755157-2755179 CCGGGCACAGGGAAGGCAGCTGG - Exonic
1161646561 19:5456655-5456677 CCAGCCTCCGGGAGCGTAGCTGG - Exonic
1161899742 19:7109585-7109607 TCAGTCTCAGGGAGGGTGGACGG - Intergenic
1161957537 19:7504909-7504931 CCAGAAAGAGGGAGGGGAGCAGG - Intronic
1162775037 19:12974452-12974474 CCAGTTGCAGGGAGGGTAGATGG + Exonic
1162821908 19:13228291-13228313 CCAGTGCCAGGGAGGGGAGGAGG + Intronic
1163452021 19:17383994-17384016 CCAGTCACAGGCAAGGAAGTAGG - Intergenic
1163519691 19:17784590-17784612 CCAGTCACAGGGAGATTTGATGG - Intronic
1164578335 19:29419024-29419046 CCAGACACAGGAAGGGCAGAGGG - Intergenic
1165906134 19:39196094-39196116 CCAGTCCCAGGCAGGGGTGCAGG + Intergenic
1167272238 19:48511915-48511937 CCTGTCACAGGAAGGGTGGGAGG + Intronic
1167760293 19:51442605-51442627 CGAGGCACAGGAAGGGCAGCGGG - Intergenic
1167946004 19:52989574-52989596 TCAGTCACAGGGAGGCTCACTGG + Intergenic
925112234 2:1346343-1346365 CCAGTCCTAGGGAGGGTAGAGGG + Intronic
925167972 2:1730576-1730598 CCAGCCACAGGCAGGGGAGGAGG + Intronic
926133269 2:10318853-10318875 CAAGCTTCAGGGAGGGTAGCAGG - Intronic
926196986 2:10769945-10769967 CCAATCAGGGGGAGGGCAGCTGG - Intronic
926197265 2:10771596-10771618 CCAGGGACAGGGAGGCTGGCAGG - Intronic
927141106 2:20131321-20131343 CAAGCCACACGGAGGGAAGCTGG + Intergenic
928716903 2:34071784-34071806 CCACTCAAATGGATGGTAGCAGG - Intergenic
928923783 2:36555207-36555229 TAAGACACAGGGAGGGAAGCGGG - Intronic
932701104 2:73992219-73992241 TCAGACTCAGGTAGGGTAGCTGG - Intronic
932886365 2:75552776-75552798 CAAGTTACAGGGAGTGTGGCTGG + Intronic
934624703 2:95836305-95836327 CCAGACACCGGTGGGGTAGCTGG + Intergenic
935638597 2:105269746-105269768 CCAGTCGCTGGGCGGGTGGCCGG - Intronic
937264259 2:120606231-120606253 CCAGGCACAGGAAGTGCAGCAGG - Intergenic
939095174 2:137826038-137826060 CCAATCACAGGCAGGCTAGTGGG + Intergenic
941203626 2:162544853-162544875 CCAATGAAAGGGAGGGTAGAAGG - Intronic
941934756 2:170973950-170973972 CCAGCCCCGGGGAGGGAAGCCGG - Intergenic
943724501 2:191238910-191238932 CCAGTCACTGAGAGGGGGGCTGG + Intergenic
947573944 2:231257615-231257637 CCAGTCACAGGGAGGGTAGCAGG - Intronic
948612115 2:239176370-239176392 CCAGGCAGAGGGAGGGAGGCCGG - Intronic
1169194589 20:3676320-3676342 CCATCTACAGGGAGGGGAGCAGG - Intronic
1170566803 20:17612176-17612198 CCAGGCACAGGGCGGGAAACGGG + Intergenic
1170873844 20:20232844-20232866 CTAGTCACACGGAGGGTCGCGGG - Intronic
1171428192 20:25061608-25061630 CCAGTCACAAGCAGCATAGCTGG - Intergenic
1172014528 20:31865039-31865061 CCAGCATCAGGGAGGGTTGCAGG - Intronic
1172776495 20:37410335-37410357 ACAGACACAGAGAGGGTAGAAGG - Intergenic
1173652869 20:44678483-44678505 CCAGTCACAGAGAGGGTGATGGG + Intergenic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1174096828 20:48096424-48096446 CCAGGCACTGGGAGGGAGGCTGG - Intergenic
1174399138 20:50266635-50266657 CAAGGCACAGGGAGGGGAGGTGG + Intergenic
1175028376 20:55927626-55927648 CAAGTCACAGGGAGGTTAACTGG + Intergenic
1175893970 20:62327926-62327948 ACAGTCACAGGGGCGGCAGCGGG + Exonic
1175983816 20:62754457-62754479 CCAGTCAGAGGCAGGGTCGGGGG + Intronic
1177134647 21:17296362-17296384 CCAGTGACAGGAAGAGCAGCAGG - Intergenic
1178623696 21:34198366-34198388 CCAGGCACGGGGAGGGTAGTAGG + Intergenic
1179488937 21:41727969-41727991 CCAGGCACAGTGAGGGTGGAGGG + Intergenic
1179721522 21:43318947-43318969 CAAGTCCCAGGGGGGTTAGCTGG + Intergenic
1179948865 21:44698444-44698466 CCAGTCCCAGGGAGGGTCAACGG + Intronic
1180061224 21:45386055-45386077 CCCTCCACAGGGAGGGAAGCAGG - Intergenic
1180061262 21:45386201-45386223 CCCTCCACAGGGAGGGAAGCAGG - Intergenic
1181562819 22:23715508-23715530 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1182395996 22:30036357-30036379 CCAGTCCCAGGAAGGGTTGGTGG - Intergenic
1182867296 22:33614775-33614797 ACAGTCTCATGGAGGGTAGGAGG - Intronic
1183170485 22:36183927-36183949 CCAGTCAGAGGGGGGGTTACAGG + Intergenic
1183263580 22:36811904-36811926 CCAGCCACAAGAAGGGCAGCTGG + Intronic
1183498881 22:38166257-38166279 CCAGCCAAAGGGAGGGTGGAAGG - Intronic
1183986230 22:41572042-41572064 CCTTCCACAGGGAGGGCAGCAGG + Exonic
1184352491 22:43953461-43953483 CAAGTCACATGGATGGGAGCAGG + Intronic
1185158131 22:49206508-49206530 GCAGGCAGAGGGAGGGTGGCTGG - Intergenic
950074995 3:10180859-10180881 CCAGTCACGGGGAGGCCAGTGGG + Intronic
951029349 3:17863769-17863791 CCAGCCTCAGGTAGTGTAGCTGG - Intronic
953788877 3:45931227-45931249 CCAGCTTCGGGGAGGGTAGCAGG - Exonic
953878489 3:46679596-46679618 CCAGTGACAAGCAGGGAAGCAGG - Intronic
953901675 3:46847109-46847131 CCAGACACCGGGGGGGGAGCTGG + Intergenic
954107181 3:48415682-48415704 ACAGCCACAGGGAGCGTGGCAGG + Exonic
954335144 3:49911905-49911927 ACAGCCACAAGGAGGGTACCAGG - Exonic
954701391 3:52452681-52452703 CCAGTCGCAGTGAGGCCAGCTGG - Intronic
955408963 3:58643605-58643627 CCAGAACCAGGGAGGGTAGGGGG - Intronic
956784941 3:72634772-72634794 CAAGACACAGAGAGGGAAGCTGG - Intergenic
958184061 3:90097005-90097027 CCTGTCATAGGGTGGGGAGCTGG - Intergenic
959357949 3:105355633-105355655 CCAGTCAAAGGGATGGGAGTGGG + Intergenic
961503504 3:127354896-127354918 CCACACACAGGCAGGGCAGCTGG - Intergenic
961523953 3:127484685-127484707 CCAGTCACAGAGAGGATGCCAGG + Intergenic
961624485 3:128252204-128252226 CCATTCACAGGGAGGGAGGCAGG - Intronic
962844352 3:139261782-139261804 CCAGACTCAGGGAGGGTAAGTGG + Intronic
964322736 3:155515096-155515118 GCAGTCACATGAAGAGTAGCTGG - Intronic
966075123 3:175926205-175926227 CCAGAGACTGGGAGGGTAGAGGG + Intergenic
966083007 3:176028506-176028528 CCAGTCACAGGGTGGGCTGGGGG - Intergenic
967652625 3:192005425-192005447 TCAATGTCAGGGAGGGTAGCAGG - Intergenic
968445604 4:650653-650675 CCACACACAGGGAGGGGGGCCGG + Intronic
968551351 4:1225315-1225337 CCAGACACAGGGAGGGACACAGG + Intronic
968574660 4:1360022-1360044 CCAGGCACAGGCAGGGGAGGAGG + Intronic
969418457 4:7076061-7076083 TCAGTCACAGGGTGGGTGGAGGG - Intergenic
969927973 4:10603047-10603069 CCAGTCACATTGGGTGTAGCCGG - Intronic
972796421 4:42425670-42425692 CCACTCACAGGCAGGTCAGCTGG + Intronic
973856584 4:55017095-55017117 CCAGTCACAGCCAGGGAGGCTGG + Intergenic
974020192 4:56686560-56686582 CCAATCACAGGAAGGGGATCAGG - Intergenic
974988552 4:69058818-69058840 GCTCTCACAGGGAGGGAAGCTGG + Intronic
977862484 4:101981185-101981207 TCAGTCACAGAGAGAGTATCAGG - Intronic
979470909 4:121094515-121094537 CCAGTCACAGGTTGGGTAACAGG + Intergenic
980727716 4:136786927-136786949 CGAGTTACATGGAGGGGAGCAGG - Intergenic
981024976 4:140068883-140068905 CCAGACAAAGCGAGGGTAGTGGG - Intronic
982578300 4:157145926-157145948 CAAGTCAAAGGGAGAGTAGTGGG + Intronic
983880922 4:172931629-172931651 CCACCCACATGGAGTGTAGCAGG + Intronic
986697526 5:10371476-10371498 CAAGTCACAGGGATGGCAGCAGG + Intronic
998129218 5:139642994-139643016 CTAGCAACAGGGAGGGGAGCAGG - Intergenic
998231429 5:140363652-140363674 CCGGTCACAGGGAAAGTAGCGGG + Intronic
998388456 5:141772061-141772083 ACACTCACAGGGAGGGAACCCGG - Intergenic
999267403 5:150275914-150275936 CCATTCTCAGGGAGGGGAGGGGG - Intronic
1001274212 5:170338695-170338717 CCAGACACAGGGATGGGAGTGGG - Intergenic
1001303094 5:170552273-170552295 CCAGGCACAGGGCTGGGAGCTGG + Intronic
1001518372 5:172373230-172373252 CCAGGCACAGGCTGGGAAGCAGG - Intronic
1002431592 5:179207359-179207381 ACAGTCTCAGGGAGGCTTGCTGG - Intronic
1002560838 5:180081075-180081097 CTTCTCAGAGGGAGGGTAGCAGG + Intergenic
1004426472 6:15510441-15510463 GCAATCACAGGGAGGGGAGGAGG - Intronic
1005885089 6:30091589-30091611 CCAGTCACAGGGAGGAAACTGGG + Intergenic
1006474210 6:34244563-34244585 CCAGGCCCAGGGAGGGCAGGAGG - Intronic
1006625511 6:35394957-35394979 TGAGCCACAGAGAGGGTAGCAGG + Intronic
1007174121 6:39884720-39884742 CCAGTCACAGAGAAAGTAGGGGG + Intronic
1007626011 6:43246786-43246808 CGGGACAGAGGGAGGGTAGCGGG + Intronic
1007767009 6:44166618-44166640 GCAGCTACAGGGAGGGCAGCAGG - Intronic
1007830550 6:44635013-44635035 CCAGTTGCAGGGAGGGGAGTGGG + Intergenic
1011663120 6:89611055-89611077 CCAGGCACAGGGAGGATTACAGG - Intronic
1012417487 6:99025783-99025805 CCAGGCACAGGCAGGGTGCCTGG - Intergenic
1013386350 6:109635566-109635588 CCAGACACAGCCAAGGTAGCGGG + Intronic
1016665205 6:146631625-146631647 CCAGTAACTGGGATGGTACCTGG - Intronic
1017607283 6:156147770-156147792 CCAGCCCCAGGGAGAGTAGCGGG + Intergenic
1018665046 6:166127722-166127744 CCAGCCACAGGGATGCCAGCTGG - Intergenic
1019271238 7:150228-150250 CCAGACACAGGCAGGGCGGCAGG + Intergenic
1019690116 7:2405722-2405744 CCTGTAACAGCGAGGGCAGCCGG + Intronic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1020132905 7:5569708-5569730 GAAGACACAGGGAGGGTGGCAGG + Intergenic
1021894836 7:25223719-25223741 GCGGTCGCTGGGAGGGTAGCTGG + Intergenic
1022163569 7:27736043-27736065 ACAGCCACAGGGAGGGAAGACGG + Intergenic
1025227662 7:57178639-57178661 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1025230783 7:57202143-57202165 CCTGGCACAGGGAGGAAAGCTGG + Intergenic
1025929100 7:65980721-65980743 CCTGTCACAGGGAGGAAGGCTGG + Intronic
1028959749 7:96735433-96735455 CCACTCACAGGCAGGATAGGTGG + Intergenic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1032643383 7:133794401-133794423 CCAGTAACATGGAGGCTACCTGG + Intronic
1033554819 7:142479608-142479630 CCACTCACAAAGAGGGGAGCAGG + Intergenic
1033557071 7:142497597-142497619 CCACTCACAAAGAGGGGAGCAGG + Intergenic
1033606656 7:142932645-142932667 CCAGTCCCAGGAAGAGCAGCTGG - Intronic
1035618719 8:1022196-1022218 CCACTCCCAGGGAGGGTGGGTGG - Intergenic
1035618763 8:1022361-1022383 CCACTCCCAGGGAGGGTGGGTGG - Intergenic
1039474086 8:37830296-37830318 CGCCTCACAGGGAGGGTCGCTGG - Intronic
1039963275 8:42265907-42265929 CCAGTCACAGAGACAGCAGCTGG + Intergenic
1041008032 8:53514852-53514874 CCAGTCAGTGGCAAGGTAGCGGG - Intergenic
1041192962 8:55372043-55372065 TCAGGCACAGGGAGAGGAGCGGG + Intronic
1041632895 8:60108031-60108053 CCAGAGACAGGGAAGGTAGCTGG - Intergenic
1045379228 8:101606450-101606472 CCAGTCTCAGGGAGGTAAACAGG + Intronic
1049470007 8:142771013-142771035 CCAGGCACAGGGAGGGAGACAGG - Intronic
1050059345 9:1688864-1688886 CAAGTCACAGGGAGGGACACAGG - Intergenic
1052733971 9:32321254-32321276 CCAGAGGCTGGGAGGGTAGCTGG + Intergenic
1056814509 9:89791795-89791817 CCAGGCCCAGGGAAGGGAGCAGG + Intergenic
1057134831 9:92680413-92680435 CCAGGCACTGGGTGGGTTGCAGG + Intergenic
1057389016 9:94627677-94627699 CGAGTCCCACGGAGGGTAGTTGG - Intronic
1057724353 9:97557560-97557582 CCTGCCACTGGCAGGGTAGCAGG - Intronic
1058408379 9:104703268-104703290 CCAGTCACAGTGAGATGAGCTGG - Intergenic
1060358270 9:122931245-122931267 CCAGTCACAGGGAAGGGAAAGGG + Intronic
1060419613 9:123458485-123458507 AAAGTCACAGAGAGGGTAGAAGG + Intronic
1061729140 9:132600010-132600032 CAGGTCACAGTGAGGGTAACAGG + Intronic
1062038604 9:134393810-134393832 CCAGCCACAGTGAGGGAAGTGGG - Intronic
1062044305 9:134418015-134418037 CCAGTAACAGGGAGGGTCCAAGG - Intronic
1062110146 9:134777736-134777758 CCAGCCAGAGGGAGGAGAGCTGG + Intronic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1186030664 X:5365870-5365892 CCACTCAAAGGGAGGTTAACAGG - Intergenic
1187993352 X:24899411-24899433 CCAGGGACAGGGAGGGCAGCAGG + Intronic
1188728767 X:33619611-33619633 CCAGTCATAGGTAAGGTAACAGG + Intergenic
1189241190 X:39525995-39526017 CCATTCACAGGCAAGGGAGCTGG - Intergenic
1189908198 X:45783353-45783375 CCACTCATAGGGAGAGCAGCAGG + Intergenic
1191110878 X:56802514-56802536 GCAGTCACAGGGCGTGTGGCAGG - Intergenic
1193032901 X:76918746-76918768 CCATTAACAGGGAGGTGAGCAGG + Intergenic
1193548060 X:82853128-82853150 CCAGTCCCAGTGAGATTAGCTGG + Intergenic
1197735475 X:129847689-129847711 CCAGTCCCAGGTGGGGTAGGGGG - Intergenic
1198416167 X:136421822-136421844 ACACTCACTGGGAGGGTCGCCGG + Intergenic
1200184524 X:154173558-154173580 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200190176 X:154210696-154210718 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200195929 X:154248498-154248520 ACAGTCACAGGGAGCCTGGCTGG + Intergenic
1200201583 X:154285616-154285638 ACAGTCACAGGGAGCCTGGCTGG + Intronic
1200280296 X:154771535-154771557 CCAGAGACTGGGAGGGTAGTGGG - Intronic