ID: 947577126

View in Genome Browser
Species Human (GRCh38)
Location 2:231284696-231284718
Sequence TTGGTTACACAGACCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 3, 2: 15, 3: 48, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947577123_947577126 15 Left 947577123 2:231284658-231284680 CCTACTCTCAGAAATGAGATACC 0: 1
1: 0
2: 1
3: 23
4: 247
Right 947577126 2:231284696-231284718 TTGGTTACACAGACCCACCCTGG 0: 1
1: 3
2: 15
3: 48
4: 159
947577125_947577126 -6 Left 947577125 2:231284679-231284701 CCATCGCATTTATTGTCTTGGTT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 947577126 2:231284696-231284718 TTGGTTACACAGACCCACCCTGG 0: 1
1: 3
2: 15
3: 48
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947577126 Original CRISPR TTGGTTACACAGACCCACCC TGG Intronic
900746897 1:4366704-4366726 TTGGTTACAGACACACACACAGG + Intergenic
902638277 1:17749582-17749604 TGGGTCACACAGAACAACCCTGG - Intergenic
902656449 1:17872462-17872484 TTGGTGACAGAGAACAACCCTGG + Intergenic
904607558 1:31706074-31706096 ATGTTCACACAGACACACCCTGG + Intergenic
905669215 1:39780152-39780174 TTGGTCACACAGACCAGCACTGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909259857 1:73473508-73473530 TTGGTTACAGAGAAGCAGCCTGG + Intergenic
910095784 1:83520061-83520083 TTGGTCATACAGACCAACTCCGG + Intergenic
910160537 1:84267511-84267533 TTGGTCATACAGACCAACCCTGG - Intergenic
910429718 1:87148695-87148717 TGGGTTTCACAGCCCCACCTTGG + Intronic
911892830 1:103394134-103394156 CTGGATACACATACCCTCCCAGG - Intergenic
912264929 1:108147825-108147847 TTGATCACACAGACCAACCCTGG - Intronic
912584780 1:110752521-110752543 TTTGTTACACAGAGCCCTCCTGG + Intergenic
912620224 1:111148641-111148663 TTGCTTACAAAGACTCACACAGG + Intronic
912813016 1:112808090-112808112 TTGCTGACACAGGCCAACCCTGG - Intergenic
912969495 1:114267288-114267310 TTGGTTACAAAGCACCTCCCAGG - Intergenic
916186465 1:162138497-162138519 TTGGTTCCCCAGATCCATCCTGG + Intronic
917123380 1:171664255-171664277 TTGGTAATACAGACCAACCCTGG - Intergenic
917873845 1:179267305-179267327 TTGATTACACAGACCCATTCTGG + Intergenic
918103411 1:181396281-181396303 TTGGTTACACAGACCAACCCTGG + Intergenic
918438800 1:184545063-184545085 TTGATCACATAGACCAACCCTGG + Intronic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919663375 1:200269470-200269492 TTGGTCACACAGACCAACCCTGG - Intergenic
919813726 1:201424898-201424920 TTTGTTTCACTGACCCTCCCAGG - Intronic
921572209 1:216793303-216793325 TTGGTCACACAGACTAATCCTGG - Intronic
922005710 1:221528685-221528707 TTAGCTACACAGATCAACCCTGG + Intergenic
922074425 1:222228981-222229003 TTGGTTGGTCAAACCCACCCTGG + Intergenic
922622704 1:227002557-227002579 TTGATCACACAGACCAGCCCTGG - Intronic
922721946 1:227903852-227903874 TGGGGTACACAGCCTCACCCTGG + Intergenic
924106935 1:240658516-240658538 TTGGACACACTGACCCACCCTGG + Intergenic
924125536 1:240846687-240846709 TTGGTTACACAAACCAACCCTGG - Intronic
1063444478 10:6101476-6101498 TTGGTTTCAAAGGCCCACCAAGG - Intronic
1064101429 10:12467765-12467787 ATGATTACACAAACCCAGCCTGG - Intronic
1064428066 10:15247570-15247592 TTGGTCACACAGACCCACACTGG - Intronic
1065216563 10:23454895-23454917 TTTGTTACAAAGACTCAGCCAGG - Intergenic
1065283315 10:24163038-24163060 TTGGTCATACAGACCAACTCTGG + Intronic
1070722065 10:78763831-78763853 AATGTTACAGAGACCCACCCAGG - Intergenic
1071387228 10:85133697-85133719 TTAGATAGACAGACCCACTCAGG + Intergenic
1071959281 10:90794053-90794075 TTGGCAACACAGATACACCCAGG + Intronic
1072205393 10:93199552-93199574 TTGTTTAGAGAGACTCACCCAGG - Intergenic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1077828254 11:5834151-5834173 TTGGTCACACAGAGCAGCCCTGG - Intronic
1077974950 11:7238287-7238309 TTGGTTACACACACTAACCCTGG - Intergenic
1080748556 11:35131007-35131029 TTGGTTTCACACAATCACCCAGG - Intergenic
1080793262 11:35539867-35539889 TGGGTCACACATACCAACCCTGG - Intergenic
1081699091 11:45141328-45141350 GTGGTCACACAGACCAACCCTGG - Intronic
1083245190 11:61421372-61421394 TTGGTTACCCACACTCACCCAGG + Exonic
1084544523 11:69808006-69808028 GTGGTAACACAGCCCCACACAGG + Intergenic
1084653022 11:70500082-70500104 TTGGCTACACCTCCCCACCCAGG - Intronic
1086371523 11:86160016-86160038 TTGGTCACAGAGACCAACCCTGG - Intergenic
1087464245 11:98485206-98485228 CTGGTTTCACAGGCACACCCAGG + Intergenic
1088162589 11:106890674-106890696 TTGATTACACACAACCACCTCGG + Intronic
1089337716 11:117736467-117736489 CTGGTCACACAAACCAACCCTGG + Intronic
1089355695 11:117851188-117851210 CTGGTCATACAGACCAACCCTGG - Intronic
1089673599 11:120073980-120074002 ATGCTTGCACAGACCCACCCTGG + Intergenic
1091370815 11:135056472-135056494 TTGGTGACAAAAACCTACCCTGG + Intergenic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1094376013 12:29787950-29787972 TTTGTTACAGAGATCCAGCCAGG - Intergenic
1095417444 12:41991858-41991880 TTCCTTGCACTGACCCACCCTGG + Intergenic
1096215980 12:49797502-49797524 TTGGGGACACAGACACAACCAGG - Intronic
1096559920 12:52428800-52428822 CTGTGCACACAGACCCACCCTGG + Intronic
1097329418 12:58317367-58317389 TTGGTCACACAGACCAACCCTGG + Intergenic
1100361515 12:93884051-93884073 TTGATCACACAGATCAACCCTGG + Intronic
1101063742 12:100998058-100998080 TTGGCCTCACAGACACACCCAGG - Intronic
1101854935 12:108434343-108434365 TTGGTAACACGGAACCATCCTGG + Intergenic
1102246353 12:111358810-111358832 TTGGTTACCCAGAACCACCCTGG + Intergenic
1103126366 12:118426118-118426140 TTGGTCACAGAGATCAACCCTGG - Intergenic
1103469119 12:121165878-121165900 TTGGTCACACAGATCAACCCTGG + Intronic
1103852861 12:123944534-123944556 TTGGAGACACTGACACACCCAGG + Intronic
1104287426 12:127437137-127437159 TTGGTCACACAGACCACCTCTGG - Intergenic
1112968951 13:105235139-105235161 GTGGATACACAGACCCACAGAGG + Intergenic
1114571492 14:23672358-23672380 TTGGTTTCCTAAACCCACCCAGG - Intergenic
1117168355 14:53063955-53063977 TTTGTTACTCAAACCCATCCTGG + Intronic
1118663798 14:68044510-68044532 TTGTCTACAGAGATCCACCCTGG + Intronic
1118886412 14:69870505-69870527 TTGGTCACACTGACCAACCCTGG - Intronic
1119873951 14:78040818-78040840 CTGGTCACACAGACCAACCCTGG - Intergenic
1121089409 14:91170761-91170783 CTGGTTCCACAGACCCTTCCTGG + Intronic
1123170989 14:106372706-106372728 TTTGTTACACACACACACCAGGG + Intergenic
1125337006 15:38636604-38636626 TTAGTCACACAGACCAACCCTGG - Intergenic
1126127978 15:45313746-45313768 TTGGTCACACAGACCAACCCTGG - Intergenic
1126412513 15:48386671-48386693 TTGGTCACATAGACCCACCCTGG - Intergenic
1128537999 15:68505044-68505066 TTGTTCACACAGAGCAACCCTGG + Intergenic
1128561535 15:68671832-68671854 TTAGTAACACAGACCAACCCTGG + Intronic
1131194655 15:90345907-90345929 TTGGTCACACAGACCAACCCTGG - Intergenic
1133191019 16:4133748-4133770 TGGGTTGCCCAGACCCGCCCAGG - Intergenic
1133697952 16:8282736-8282758 TTGGTCACACAGATCAACCTTGG + Intergenic
1136418659 16:30118545-30118567 ATGGTTCCGCAGACCCCCCCAGG + Intronic
1137419510 16:48319752-48319774 TTGGTCACACAGCCCAACCCTGG + Intronic
1138035462 16:53601162-53601184 CTGGTTACCCAGATACACCCTGG + Exonic
1138361970 16:56438148-56438170 TTGGTCACACAAGCCAACCCTGG - Intronic
1138803654 16:60066150-60066172 TTGATCACACAGACCAACCCTGG + Intergenic
1141473130 16:84252806-84252828 TGGGCTACACAGACTCACCCAGG - Intergenic
1143213996 17:5210398-5210420 TTGGTTGTGCAGACCCTCCCAGG - Exonic
1143314043 17:6017815-6017837 TTGGTCATACAGACCCACCGTGG - Intronic
1148612948 17:48976897-48976919 TTGGTCACACAGACCAATCCTGG + Intergenic
1148748148 17:49929841-49929863 TTGGTGACAGAGCCCCGCCCGGG + Intergenic
1149343986 17:55715914-55715936 TTGTTTACACAAACCAACTCTGG + Intergenic
1151439924 17:74121804-74121826 TTGGTCACACTGACCAACTCTGG + Intergenic
1152244150 17:79176503-79176525 TTGGTTTCACAGTCCCTCCGGGG - Intronic
1155864450 18:30947521-30947543 TTGGTCACACAGGCCCACCCTGG - Intergenic
1158458115 18:57625080-57625102 CTGGTCACACAGACCAGCCCTGG + Intergenic
1159563603 18:70023019-70023041 TGGGTCACACATACCAACCCTGG - Intronic
1160786387 19:901858-901880 TTGGGTCCCCAGCCCCACCCAGG + Intronic
1160891502 19:1381016-1381038 TTGGTCACACAGAGCAGCCCCGG + Intergenic
1161038736 19:2099003-2099025 TGGGACACACAGAGCCACCCCGG + Exonic
1161191375 19:2958889-2958911 ATGGATACACAGACTTACCCAGG - Intergenic
1166640805 19:44493631-44493653 TTGGTCACACAGACCCACCTTGG - Intronic
1168466761 19:56608621-56608643 TTGATCACACAGAATCACCCTGG + Intronic
925930055 2:8699793-8699815 TTGGTCACACAGACCAACCGTGG + Intergenic
926062008 2:9810319-9810341 GTGGTAACATAAACCCACCCAGG - Intergenic
926341712 2:11909573-11909595 TTGGGTCCTCAGACCAACCCTGG + Intergenic
926733207 2:16052950-16052972 TTGGTAACACAGACACACCCAGG + Intergenic
930120643 2:47757883-47757905 TTGGTAAGACAGAGTCACCCAGG + Intronic
930944983 2:57062441-57062463 TTGGTCACACAGATCCAACCTGG - Intergenic
930957479 2:57219766-57219788 TTGTTGACAAACACCCACCCAGG - Intergenic
935462444 2:103354210-103354232 TTGGTCACACAGACCAACTCTGG + Intergenic
937154978 2:119712494-119712516 TTGGATACACAGAGACACCAGGG + Intergenic
938369395 2:130759898-130759920 TTGGTTACACCCACCTAACCAGG - Intronic
939604553 2:144237759-144237781 TTGATCACTCAGACCAACCCTGG - Intronic
940811875 2:158252983-158253005 GTGGTTCCACAGACCAAACCAGG - Intronic
942436324 2:175981143-175981165 TTGGTGGCACAGACCAACACTGG - Intronic
942701454 2:178715764-178715786 TTGGTTCCATAGAACCACCCAGG - Exonic
942887676 2:180947494-180947516 TTGGTCATACAGATCAACCCTGG + Intergenic
943761822 2:191618350-191618372 TTGGTCACACAGACCAACTTTGG - Intergenic
946457614 2:219840630-219840652 TTGGTCACACAGAATAACCCTGG - Intergenic
946478865 2:220034377-220034399 TTGGGGACACAGTACCACCCAGG - Intergenic
946797572 2:223372137-223372159 TGGGTTTCTCAGAGCCACCCTGG - Intergenic
947577126 2:231284696-231284718 TTGGTTACACAGACCCACCCTGG + Intronic
947751768 2:232536266-232536288 TTGGTTACCCAGACCCACCCTGG - Intronic
1168743523 20:215736-215758 TTGGTTACAAAGATCTTCCCAGG - Intergenic
1170094432 20:12630237-12630259 TTGTTTACACAGACTCATCACGG - Intergenic
1173833815 20:46112169-46112191 TTGGTCACACAGACCAACCCTGG + Intergenic
1173944351 20:46938757-46938779 TTGGTCACACAGACCAACCCAGG + Intronic
1175003639 20:55658230-55658252 TTGGTCACACACACCAACCCTGG + Intergenic
1175571722 20:60028097-60028119 ATGATTACACAGACCTACCCAGG - Intronic
1175654713 20:60760088-60760110 TTGGTCTCGCAGACCAACCCTGG + Intergenic
1178890866 21:36520191-36520213 TTGGACACACAGACCCACAGAGG - Intronic
1179352289 21:40623634-40623656 TTGTTTGCAGAGACCCACACAGG - Intronic
1179790396 21:43752926-43752948 TTGTTTACACAGACACCACCTGG + Intronic
1179793141 21:43767134-43767156 TTGTTTACACAGACACCACCTGG + Intergenic
1185114534 22:48924317-48924339 TTGCTTACACAGACCGAGCAAGG - Intergenic
949310178 3:2688764-2688786 GTGGTTACAAAGACCCACGTAGG - Intronic
950154282 3:10709993-10710015 TAGGTTCCACAGCCTCACCCAGG + Intergenic
952047166 3:29336769-29336791 TTGGTTAAACATTCCAACCCAGG + Intronic
956389423 3:68755586-68755608 TTGGTCATATAGACCAACCCTGG - Intronic
959614318 3:108330216-108330238 TTGGTTATACAGACCAGCCCTGG + Intronic
960953528 3:123014980-123015002 TTGGTGACACACACGCACACAGG + Intronic
962769427 3:138598805-138598827 TTGGTCACATAGACCAACCGTGG + Intergenic
963738971 3:149055803-149055825 TTGGTCACACAGACCAGTCCTGG - Intronic
966208332 3:177427391-177427413 TTGGTTATCCAGACCAACCCTGG + Intergenic
972718227 4:41670000-41670022 TTCCTTACACACACACACCCAGG + Intronic
972908244 4:43778399-43778421 TTGGTCACACATGCCAACCCTGG - Intergenic
973920660 4:55681675-55681697 TTGGTCAGACACACCAACCCTGG - Intergenic
976612030 4:87040285-87040307 TTGGTTAAACTGATCCACACAGG - Intronic
976817290 4:89163812-89163834 TGGGTCACACAGACCAACCCTGG + Intergenic
982485092 4:155956897-155956919 TTGGTTACACAGAGCCAGTCTGG + Intergenic
983198773 4:164838076-164838098 TTGGTTACACAGACCAACCCTGG - Intergenic
986690655 5:10311058-10311080 TTGGTCACACAGACCAACCATGG - Intergenic
987539604 5:19237311-19237333 TGGTTTACACAGAACCATCCAGG - Intergenic
989375739 5:40757922-40757944 TAGGTAACACAGACCAACCGTGG - Intergenic
989695097 5:44190943-44190965 CTGGGTCCACAGACTCACCCAGG - Intergenic
989793555 5:45438087-45438109 TTGGTAACACAGGCCAACCTTGG + Intronic
992361546 5:76043280-76043302 TTGGTCACACAGACCAATCCTGG - Intergenic
994213644 5:97112940-97112962 TTGGTTACACAAACGAACTCTGG - Intronic
995206398 5:109486146-109486168 TGAGTCACACAGACCAACCCTGG - Intergenic
995528357 5:113068561-113068583 TCTGTCACACAGACCAACCCTGG - Intronic
996151676 5:120044717-120044739 TTGGTCACACAAACCGTCCCTGG - Intergenic
997247907 5:132366878-132366900 TTGGTCACATAGACCAATCCTGG + Intergenic
998079607 5:139263578-139263600 TTGGTCACACAGACAAACCCTGG - Intronic
999340257 5:150764081-150764103 TTGGTCACACAGACCAACCCTGG - Intergenic
1003415718 6:5906115-5906137 TTGCTCACACAGACCATCCCTGG + Intergenic
1005430044 6:25746807-25746829 TTGGTTGCACAGGCCAACCCTGG - Intergenic
1006172934 6:32105662-32105684 TTGGTTAGACACAGCCACCAGGG + Intronic
1006294274 6:33163062-33163084 TGGGTTAGAGAGCCCCACCCTGG + Exonic
1006734805 6:36265886-36265908 TTGGTCACACAGACCAGCCCTGG - Intronic
1007556309 6:42769414-42769436 TTGGTCACCCAAACCAACCCTGG + Intronic
1007735852 6:43981771-43981793 GTGGTCACTCAGGCCCACCCAGG - Intergenic
1007839987 6:44708245-44708267 TTGGATACACAGACAGACACAGG - Intergenic
1012079240 6:94735472-94735494 TGGGATACACATCCCCACCCCGG + Intergenic
1014245618 6:119065127-119065149 TTGGTTACATGGACCAACCATGG - Intronic
1015785526 6:136919058-136919080 TTAGCTACACAGACCAACCCTGG + Intergenic
1015796716 6:137019984-137020006 TTGGACACACAGACCAACCCAGG - Intronic
1017145105 6:151227638-151227660 TTGGGCACACAGTCCAACCCTGG + Intergenic
1019477708 7:1251969-1251991 TTGGTGACATAGAGCCCCCCTGG + Intergenic
1022002300 7:26237428-26237450 TTGGTCACACAGACCAAGGCTGG - Intergenic
1023296375 7:38718979-38719001 TTGGTCACACAAACCAACCCTGG + Intergenic
1023385351 7:39651335-39651357 TTTGTCACACAGACCGACCCTGG + Intronic
1027050664 7:75019421-75019443 TAGGAGACACAGACCCACCCCGG + Intronic
1028559483 7:92158125-92158147 TTGATCACACAGACCAACCTTGG - Intronic
1028586974 7:92461890-92461912 TGGGTCACACAGACCAACTCTGG + Intergenic
1029382388 7:100222285-100222307 TGGGAGACACAGACCCGCCCCGG - Intronic
1031064211 7:117086988-117087010 TGGGTTACACACCCTCACCCAGG + Intronic
1031415934 7:121496690-121496712 TTGGTCACACAGTCCCTCCCTGG - Intergenic
1031445859 7:121852784-121852806 GAGGTCACACAGACCAACCCTGG - Intergenic
1031979176 7:128113296-128113318 CTGGACACACAGGCCCACCCAGG - Intergenic
1032292444 7:130600897-130600919 TTGGTCACACAGACAAACTCTGG - Intronic
1033241527 7:139683594-139683616 TGGGTCACACAGACCAATCCTGG + Intronic
1034350748 7:150413343-150413365 ATGGTCACACGGACCCAGCCAGG + Intergenic
1034749251 7:153553599-153553621 TTGTTTACACACACCCACAGGGG + Intergenic
1036155161 8:6334916-6334938 TTGGTTTCACTGAACCACACAGG - Intergenic
1037298792 8:17430104-17430126 TTGGTTCCAAATGCCCACCCAGG + Intergenic
1038490847 8:27970002-27970024 TTGGTCACACAGGCCAATCCTGG - Intronic
1042760972 8:72271121-72271143 CTGGTTACATAGACCTAACCAGG + Intergenic
1043425172 8:80141331-80141353 TTGGTCACACAGACCAACCCTGG - Intronic
1045372084 8:101534521-101534543 TTGGTCATATAGACCAACCCTGG + Intronic
1048981864 8:139706661-139706683 TGGGACACCCAGACCCACCCGGG - Intergenic
1050078266 9:1888021-1888043 TTGGTCACCCAGACCAACTCTGG + Intergenic
1050163794 9:2743908-2743930 TTGGTCACACAGACCAGCCCTGG - Intronic
1052257671 9:26477859-26477881 TTGGCCACACAGACCAACTCTGG - Intergenic
1053196910 9:36126619-36126641 CTGTTTGCTCAGACCCACCCAGG - Intergenic
1054763618 9:69024874-69024896 CTGGTCACACAGACCAACCCTGG + Intergenic
1055116035 9:72606412-72606434 TTGGTCACACACACTAACCCTGG + Intronic
1056550395 9:87648651-87648673 TTGGTTCCACCCACCCACCTTGG - Intronic
1058330095 9:103749889-103749911 TTAGTTACTCACACCTACCCTGG - Intergenic
1060875137 9:127077746-127077768 TTTGTTCCACAGATCCATCCTGG + Intronic
1061389673 9:130310546-130310568 TTGGTCCCACAGAGCAACCCTGG + Intronic
1186904712 X:14098975-14098997 TTGGTCACACAGACTGACCCTGG + Intergenic
1189135706 X:38547190-38547212 TTGGTCACACAGACCAACAATGG - Intronic
1189146893 X:38664767-38664789 TTGGTGACACTTCCCCACCCTGG - Intronic
1189651577 X:43195504-43195526 TTGGTCACACAGACCAACACTGG - Intergenic
1194570960 X:95554103-95554125 CTGGTTACACAGACACAACCAGG - Intergenic
1195563385 X:106311700-106311722 ATGGTTACACACATCCACCCAGG + Intergenic
1195773298 X:108375285-108375307 ATTGTTATACAGACCCACACAGG - Intronic
1196551514 X:117032128-117032150 TTGCAGACACAGACCCAGCCTGG - Intergenic
1200210236 X:154343864-154343886 TTGGTCTCACAGGTCCACCCTGG + Intergenic
1200220616 X:154388228-154388250 TTGGTCTCACAGGTCCACCCTGG - Intergenic