ID: 947579576

View in Genome Browser
Species Human (GRCh38)
Location 2:231306591-231306613
Sequence CAATCAGAACTAGCTAGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947579576 Original CRISPR CAATCAGAACTAGCTAGACC GGG Intronic
909295511 1:73942876-73942898 TAATCAGAGCTAGCCAGACTAGG - Intergenic
909729377 1:78874058-78874080 TAATCTCAACTAGCTATACCTGG - Intergenic
913536069 1:119773848-119773870 CAATCAGAAAAGGCAAGACCTGG - Intergenic
915092234 1:153434642-153434664 AAATCAAAACCAGCTAGAACTGG + Intergenic
918938032 1:190950205-190950227 AAAACAGATCTAGCTACACCCGG + Intergenic
923292441 1:232559341-232559363 CAATCAGCTCCAGCTAGACCCGG + Intronic
1066635862 10:37499358-37499380 GGATCAGAACTAGCTACATCTGG - Intergenic
1068121749 10:52787764-52787786 TAATCAGAACTAGGTTGAACTGG - Intergenic
1070259529 10:74841217-74841239 GAGGCAGAACTAGCTAGAGCAGG + Intronic
1073423769 10:103443822-103443844 CACTCACAAGAAGCTAGACCTGG - Intronic
1083132708 11:60640765-60640787 CAAAAAAAATTAGCTAGACCTGG - Intergenic
1084726366 11:70945027-70945049 CAAGCAGAACTAAATAGTCCGGG - Intronic
1090733802 11:129593862-129593884 AAAACAGAAATAGCCAGACCTGG + Intergenic
1095396194 12:41765047-41765069 TAATCACAAGTAGCTATACCTGG - Intergenic
1100256212 12:92886209-92886231 CAATCAGAACTAGCTGGACATGG + Intronic
1103085489 12:118059956-118059978 CAATCAGAACCCTCCAGACCAGG + Intronic
1105282830 13:18978906-18978928 TAATCAGAACTAGTTCCACCTGG - Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1121456676 14:94042972-94042994 CAATCAGGACAAACTAGTCCTGG + Intronic
1123456676 15:20432600-20432622 CAATTTCAACTAACTAGACCAGG + Intergenic
1123661386 15:22567760-22567782 CAATTTCAACTAACTAGACCAGG - Intergenic
1124262823 15:28207742-28207764 CAATTTCAACTAACTAGACCAGG + Intronic
1124315186 15:28661992-28662014 CAATTTCAACTAACTAGACCAGG - Intergenic
1125380759 15:39084238-39084260 CAATGAGATCTAACTGGACCAGG - Intergenic
1126959808 15:53978776-53978798 CAATCACAAATAGTTAGAACAGG - Intergenic
1127957933 15:63869253-63869275 CAATGAGAACTGGCTAAACAGGG - Intergenic
1128865695 15:71114119-71114141 CAATCAGAACTGGCTCTGCCAGG + Intronic
1133450616 16:5900874-5900896 TAATCAGAACTATGTAGACTTGG - Intergenic
1135510966 16:23082697-23082719 CAATCAAAAGTAGCCAGAGCTGG + Intronic
1139679246 16:68547981-68548003 AAATCAAAACTAGCCAGACATGG - Intronic
1147623157 17:41881628-41881650 AAATCAGATCTTGGTAGACCTGG - Intronic
1149613379 17:57975726-57975748 CAAAGAGAACTAGCTAGGCAAGG + Intronic
1153275828 18:3366726-3366748 CAATCAGAACTAGAAAGAAAGGG + Intergenic
1154449415 18:14462013-14462035 CAATCACAACTAGTAAAACCAGG + Intergenic
1155582077 18:27320883-27320905 CAATCAGAACTTGTTATAGCAGG + Intergenic
1157223192 18:45841483-45841505 CCATCAGAACAAGCTGGCCCAGG + Intronic
1157235514 18:45961563-45961585 CAATAAGAACTAGCCAGGCTGGG + Intronic
1159590676 18:70332078-70332100 CAAGCAGAGCTTGCTAGATCAGG + Intergenic
928654607 2:33437627-33437649 AAAGCAGAACCAGCTAGAACCGG + Intronic
936085783 2:109468064-109468086 TAATCAAAACTAGCTAGATACGG + Intronic
938131454 2:128719029-128719051 CAAAAAGAATTAGCTAGACTTGG + Intergenic
938696819 2:133842233-133842255 CCACCACATCTAGCTAGACCAGG + Intergenic
945943029 2:215968649-215968671 CAATCAAAACTTACTAGTCCTGG + Intronic
947579576 2:231306591-231306613 CAATCAGAACTAGCTAGACCGGG + Intronic
1176672655 21:9749160-9749182 CAATCTGAACTTGCTAGACAAGG - Intergenic
1176999072 21:15589594-15589616 CAATAAGAAATAGAAAGACCAGG + Intergenic
1182449260 22:30409068-30409090 CAATCAGAGCTAGTTAGGGCCGG - Intronic
1182470954 22:30547978-30548000 CAATCAGGACTATCTGGACCTGG + Intergenic
950568538 3:13786108-13786130 CACTCAGAACAAGCCAGTCCAGG - Intergenic
951697566 3:25461597-25461619 TAATAAGAACTGGCTAGGCCAGG + Intronic
951724176 3:25737696-25737718 CAAACAAAATTAGCCAGACCTGG - Intronic
957377552 3:79378267-79378289 CATTCAGAACTAACTAGTCTGGG + Intronic
963628138 3:147698877-147698899 CCATAAGAACCAGCTAGACATGG - Intergenic
971156059 4:24084215-24084237 CAATCAGTACTGGTTAGTCCTGG + Intergenic
972625744 4:40797039-40797061 CAGACAGACCTAGGTAGACCAGG - Intronic
982753211 4:159187801-159187823 GCATCAAAAATAGCTAGACCTGG - Intronic
985402064 4:189602670-189602692 CAATCTGAACTTGCTAGACAAGG + Intergenic
987262565 5:16218567-16218589 CAATAAGAACTAGGCACACCTGG - Intergenic
992803741 5:80316733-80316755 AAACCAGAACTAGCTAGGCGTGG + Intergenic
993486882 5:88497703-88497725 AAATCAGATCTAGCTAGAATAGG - Intergenic
994617701 5:102127223-102127245 CAATCAGAACCAGCTATGTCTGG - Intergenic
998461249 5:142311773-142311795 CAAGAAGAACAAGCTAGAACAGG + Exonic
999650478 5:153762569-153762591 AAATCATAAGTAGGTAGACCAGG - Intronic
1000825025 5:166034336-166034358 GAATCAGACTTAGATAGACCAGG + Intergenic
1010879465 6:81150203-81150225 CAATCAAAACTAGAGAGAGCTGG + Intergenic
1011098671 6:83696301-83696323 CAATCAGAACTAGGTGAACAAGG + Intronic
1018431818 6:163728869-163728891 CAATCAAAACTATCTCGACAGGG - Intergenic
1019583733 7:1784039-1784061 CAATCAAACCTAAATAGACCTGG - Intergenic
1023931763 7:44710455-44710477 CAGTCAGAACATGCTGGACCAGG + Intergenic
1025950045 7:66137601-66137623 CAATCTGAACTTCCTAAACCTGG - Intronic
1048685865 8:136904735-136904757 CAATGAGGACTAGCTAAAACAGG - Intergenic
1051628789 9:19124069-19124091 CTGTCAGAACTAGATAAACCAGG - Intronic
1056824776 9:89869250-89869272 CAATCAGAAGTAGATTTACCTGG - Intergenic
1061111868 9:128578400-128578422 CTATCAGAAGCAGGTAGACCAGG - Intronic
1186277498 X:7955974-7955996 CAATCAGACCTCATTAGACCTGG - Intergenic
1189667055 X:43366954-43366976 CAATAAGAAAAAGCTAGACAAGG + Intergenic
1193628785 X:83853957-83853979 CACTCAGAACAAGTGAGACCAGG - Intergenic
1197311209 X:124908020-124908042 AAATCAGAACTACCTAGAAGTGG - Intronic
1199074013 X:143509968-143509990 CAAGCAGCACAAACTAGACCGGG + Intronic
1199093012 X:143713205-143713227 CAAGCAGCACAAACTAGACCAGG + Intronic