ID: 947579597

View in Genome Browser
Species Human (GRCh38)
Location 2:231306813-231306835
Sequence CACTGCCCAGATCCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947579597_947579600 -5 Left 947579597 2:231306813-231306835 CCACACAGAGGATCTGGGCAGTG 0: 1
1: 0
2: 0
3: 23
4: 207
Right 947579600 2:231306831-231306853 CAGTGAGTCTTGAACAACAGGGG 0: 1
1: 0
2: 1
3: 13
4: 166
947579597_947579599 -6 Left 947579597 2:231306813-231306835 CCACACAGAGGATCTGGGCAGTG 0: 1
1: 0
2: 0
3: 23
4: 207
Right 947579599 2:231306830-231306852 GCAGTGAGTCTTGAACAACAGGG 0: 1
1: 0
2: 0
3: 14
4: 147
947579597_947579598 -7 Left 947579597 2:231306813-231306835 CCACACAGAGGATCTGGGCAGTG 0: 1
1: 0
2: 0
3: 23
4: 207
Right 947579598 2:231306829-231306851 GGCAGTGAGTCTTGAACAACAGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947579597 Original CRISPR CACTGCCCAGATCCTCTGTG TGG (reversed) Intronic
900283535 1:1888280-1888302 CACTGCCCAGGCCCAGTGTGAGG - Intronic
900403692 1:2483305-2483327 CTCTGGCCACATCCTCAGTGGGG + Intronic
900987903 1:6083668-6083690 CAGCGCCCAGCTCCCCTGTGAGG - Intronic
903970077 1:27113088-27113110 CACAGACCATATCATCTGTGAGG - Intronic
906791220 1:48660138-48660160 CCCTGCCCATGACCTCTGTGAGG - Intronic
907249166 1:53126545-53126567 CTCTGGCCAGAGCCTCTCTGTGG - Intronic
907268228 1:53275592-53275614 CACAGAACACATCCTCTGTGAGG - Intronic
907387560 1:54135992-54136014 CACTGCCCAGTGACTCTGTGAGG + Intronic
908786152 1:67736512-67736534 CACGGCCCAGCTGCACTGTGTGG + Intronic
909191582 1:72559086-72559108 CACCACAGAGATCCTCTGTGTGG + Intergenic
910489077 1:87748075-87748097 CACTGTGCAGATTCCCTGTGAGG + Intergenic
913611964 1:120517252-120517274 CACTGGCTAGTTCCTCTGAGAGG - Intergenic
914579226 1:149004987-149005009 CACTGGCTAGTTCCTCTGAGAGG + Exonic
914767127 1:150648345-150648367 CACAGCCCAGATCATTTCTGTGG + Exonic
914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG + Intergenic
915558580 1:156673854-156673876 CAATGACCTCATCCTCTGTGTGG + Intronic
916622865 1:166519958-166519980 CAATGCCAAGATCCTCTTTCAGG + Intergenic
916785963 1:168087295-168087317 CACAGCCCAGATCCTGGGTGAGG - Intronic
918145377 1:181751461-181751483 CACACCCCAGTACCTCTGTGTGG - Intronic
919806757 1:201385119-201385141 CACTGCCCATGAGCTCTGTGGGG + Intronic
922591664 1:226781993-226782015 CTCTCCTCAGAGCCTCTGTGAGG - Intergenic
922739679 1:228008050-228008072 CACTGCACATATCCTGTGGGAGG + Intronic
923226675 1:231944271-231944293 CACTGCCCAGATCCTTCTTCTGG + Intronic
1063386279 10:5618171-5618193 CACTGCCCAGATGCAGAGTGTGG - Intergenic
1063448478 10:6135036-6135058 CACTTCCCAGCTCCTCCTTGTGG - Intergenic
1065079015 10:22109825-22109847 CACTGCCCAGATCTCCCTTGAGG + Intergenic
1067848311 10:49739786-49739808 CAATGCCCTGGTCCTCTGGGAGG - Exonic
1069661491 10:70126496-70126518 CACTGCCCTGATCATCTTTGCGG + Intronic
1069995794 10:72341341-72341363 GGCTGCCCAGATCCACTGAGGGG - Intronic
1070677330 10:78421064-78421086 CACTTCCCACATCCTCTTTTGGG - Intergenic
1070731043 10:78828435-78828457 CACTGCCCAGATACCCTCTGGGG - Intergenic
1070918777 10:80171149-80171171 CACTCCCAAGACCCTCTGTGGGG + Intronic
1073887864 10:108062099-108062121 CATTGCCAAGCTCCTCTGTTTGG + Intergenic
1074384745 10:113007782-113007804 CCCTCCCCAGATCCTCTCTTTGG - Intronic
1075023264 10:118966636-118966658 CACTGCCTAGATATTCTCTGCGG + Intergenic
1075081123 10:119384612-119384634 CACTAGCCAGAGCCTCTTTGTGG + Intronic
1076234839 10:128855739-128855761 CACGGCCAAGATGCTGTGTGCGG - Intergenic
1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG + Intergenic
1076727782 10:132421480-132421502 CCCTGCCCAGCTTCTCTGCGGGG + Intergenic
1076830065 10:132989600-132989622 CACAGCCCAGATCCCATGTGTGG - Intergenic
1077021391 11:418676-418698 CACTGCCCAGACCCACTCCGAGG + Intronic
1077479397 11:2806568-2806590 CACGGCCCAGCTGCTCGGTGGGG - Intronic
1077557406 11:3232221-3232243 CAGTCCCCAGAGCCTCTGGGCGG + Exonic
1077929894 11:6720352-6720374 CACTGCCCAGATCCAGAATGGGG - Intergenic
1078740961 11:14065869-14065891 CCTTGGCCAGATCCTCTGTTAGG + Intronic
1078906126 11:15689510-15689532 AACTGCCCAGGTCCTCTGATAGG + Intergenic
1079481469 11:20885164-20885186 AACTGCCCACAAACTCTGTGGGG - Intronic
1080329232 11:31116009-31116031 CACTGCCCAGATTCCCTCTCAGG - Intronic
1081694290 11:45098815-45098837 CTGTTCCCACATCCTCTGTGTGG - Intronic
1083591016 11:63894934-63894956 CAGTGCCCAGGTCCTGTGGGTGG - Intronic
1084364510 11:68688758-68688780 CAGCGCCCAGCTCCTCTGTAGGG + Intronic
1084553625 11:69863499-69863521 CACTTCCCTGCTCGTCTGTGTGG + Intergenic
1085045543 11:73350897-73350919 CACTGCACAGACCCCCTGTGGGG - Intronic
1085643088 11:78205699-78205721 CACACCCCAGAACATCTGTGGGG + Intronic
1086420150 11:86630825-86630847 CACTGCCTGCATACTCTGTGTGG - Intronic
1087894515 11:103572702-103572724 CACTGCACTGATCCTCCATGGGG - Intergenic
1088764507 11:112962648-112962670 CACTGCCGAGGTTCTCTGGGCGG - Intronic
1089057823 11:115600986-115601008 CACTGCCCAGCACCAGTGTGTGG + Intergenic
1091656143 12:2348176-2348198 CACTGCCCAGCTCCTCCGGCTGG - Intronic
1093908045 12:24715000-24715022 CACAGATCAGATCCCCTGTGAGG - Intergenic
1095983336 12:47984800-47984822 CAATGCCCCGAGGCTCTGTGGGG + Intronic
1098025220 12:66194296-66194318 CACTGCTCTGTTCCTCTTTGTGG + Intronic
1102947405 12:117001675-117001697 CACTGCCCATGCTCTCTGTGGGG + Intronic
1103998479 12:124845067-124845089 CCCTGCGCCCATCCTCTGTGTGG - Intronic
1104259795 12:127172078-127172100 CACTGCCCAGGCCCTGAGTGGGG + Intergenic
1106038381 13:26066494-26066516 CGCTGCCCAGATTCTAAGTGTGG - Intergenic
1113878348 13:113608396-113608418 CTCTGCCCAGTTCCCCTGTATGG - Intronic
1114606343 14:24000970-24000992 CACTGCCCTCAGCCTGTGTGGGG - Intronic
1114611894 14:24048263-24048285 CACTGCCCTCAGCCTGTGTGGGG - Intergenic
1115572835 14:34683012-34683034 CACGGCCAACTTCCTCTGTGGGG - Intergenic
1116557141 14:46325327-46325349 CACTGCCCAGATCCTCCTGTAGG + Intergenic
1120913464 14:89689072-89689094 TATTGCTCAGTTCCTCTGTGAGG + Intergenic
1121012543 14:90529312-90529334 CTCTGCCTGGAACCTCTGTGTGG - Exonic
1121719390 14:96098654-96098676 CACTGCCCAGATGCCCTGGGAGG + Intergenic
1122136010 14:99633390-99633412 CTCTGCTCAGTTCCTCTGTGGGG - Intergenic
1122327241 14:100890207-100890229 CAGTGCCCAGAGCCTCTGTCGGG + Intergenic
1122874294 14:104656437-104656459 CAGTGCCTAGCTCCTCGGTGTGG + Intergenic
1122938245 14:104969848-104969870 CACTGCCCTGGACGTCTGTGGGG - Intronic
1122988764 14:105226454-105226476 CACTTCCCAGAGTCTGTGTGAGG + Intronic
1126176298 15:45738911-45738933 CACTGATCAGATGCTGTGTGTGG + Intergenic
1127824997 15:62695391-62695413 CACTGCCCAGAGCATCACTGTGG - Intronic
1132656660 16:1044372-1044394 CACTGCCCAGAAGCTCAGCGGGG + Intergenic
1133278547 16:4652257-4652279 CACTGCCCAGGGTCCCTGTGCGG - Intronic
1133356826 16:5142966-5142988 CACTGCCCAGATTCTCCCTGGGG - Intergenic
1134079116 16:11312876-11312898 CAGTGCCCAGATCCTGGGTGGGG - Intronic
1135540648 16:23327671-23327693 CTCTGCCCAGCTTCTCTGTATGG - Intronic
1135721603 16:24822631-24822653 CACTCCCCAGATCCCCACTGTGG - Intronic
1136041061 16:27579240-27579262 TACTGCTCAGAGCCACTGTGAGG + Intronic
1136056762 16:27695463-27695485 CACTTCCCTGGTCCTCTGCGAGG + Intronic
1139056758 16:63195032-63195054 CACTGCTCATACCCTCAGTGTGG - Intergenic
1139653879 16:68375964-68375986 CCCTGCCCTGCTCCTGTGTGCGG + Intronic
1140922166 16:79549587-79549609 CACTGGCCATGTCCTCAGTGTGG + Intergenic
1141004627 16:80340363-80340385 CACAGCCCAAATCCTCTTTCAGG - Intergenic
1141647341 16:85374824-85374846 GACAGCCCCCATCCTCTGTGGGG + Intergenic
1142280588 16:89145728-89145750 CAGTCCCCAGATCCACCGTGGGG + Intronic
1142283847 16:89163033-89163055 CAGAGCTCAGCTCCTCTGTGAGG + Intergenic
1143685101 17:8507534-8507556 CACTGGCCAGTCCCTTTGTGAGG + Intronic
1144334467 17:14256424-14256446 CAAAGCCCAAATCCTCAGTGTGG - Intergenic
1144944888 17:18964784-18964806 CCCTGCCCAGAGGCTCTGCGTGG - Intronic
1144950562 17:18991470-18991492 CCCTGCCCAGGACCTCTGAGAGG - Intronic
1146941121 17:36845194-36845216 CGGTGCCCAGAGCCTCTGAGGGG + Intergenic
1148053080 17:44778841-44778863 CCCTGCCCAGCTCCACTCTGTGG - Intronic
1151703290 17:75754362-75754384 CACAGCCCATATCCTCTGGCCGG - Intronic
1152204335 17:78966492-78966514 CACGGCCAAGAGCCTCTTTGGGG - Intergenic
1152422474 17:80201577-80201599 CACACACCAGAGCCTCTGTGGGG - Intronic
1155238435 18:23843992-23844014 CATTGCCCAGACTCTCTGTGTGG + Intronic
1156046104 18:32879087-32879109 CACTGCCTAGAGGCTCTGAGAGG + Intergenic
1157502731 18:48202615-48202637 CTCTGCTCAGATCCTCAGTGGGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160579074 18:79873453-79873475 GTCTTCCCAGATCCTCTGCGTGG + Intronic
1161419351 19:4167766-4167788 CACCTCCCAGAGACTCTGTGAGG + Intronic
1164121854 19:22272936-22272958 CACTGCATTGATCCTCCGTGGGG + Intergenic
1166966804 19:46533903-46533925 CCTTGCCCAGGACCTCTGTGGGG - Intronic
1168613036 19:57815916-57815938 CGCTGCATTGATCCTCTGTGGGG - Intronic
926817500 2:16814494-16814516 CTCTTCCCAGTTCCTCAGTGTGG + Intergenic
928936685 2:36686593-36686615 CAATGCCCAGAACTTCTGTTTGG - Intergenic
930758124 2:54999858-54999880 CTCTGCACAGATCCTTTTTGTGG - Intronic
931445137 2:62320845-62320867 AAATGCCTAGATCCCCTGTGTGG - Intergenic
934082766 2:88483497-88483519 CACTGCCCTGCTCCTTGGTGTGG + Intergenic
934990405 2:98916327-98916349 CCCTCCCCAGATCCCCTGTAGGG - Intronic
936279857 2:111128941-111128963 CACACTCCAGCTCCTCTGTGAGG - Intronic
938317525 2:130340354-130340376 CTCTGCTCAGAGCCTCTCTGTGG + Intronic
938934632 2:136117419-136117441 CACCGCGCCGATCCTCTGAGGGG - Intronic
939432508 2:142130008-142130030 CACAGCCCAGGTGCTCTGAGGGG - Intronic
941745260 2:169080354-169080376 CACAGACCTGCTCCTCTGTGGGG + Intronic
943395523 2:187328593-187328615 CAGGGCCCAGCTGCTCTGTGCGG + Intergenic
946075609 2:217071198-217071220 CTCGGCCCAGAACTTCTGTGTGG + Intergenic
947579597 2:231306813-231306835 CACTGCCCAGATCCTCTGTGTGG - Intronic
947760259 2:232599070-232599092 GACTGCCCATCTCCTCTGTGGGG - Intergenic
947774684 2:232697904-232697926 CTCCGTCCAGATGCTCTGTGGGG - Intronic
947989018 2:234472632-234472654 CTCTGCTCTAATCCTCTGTGTGG - Intergenic
948054474 2:235000825-235000847 CACTGCCAGCAGCCTCTGTGTGG + Intronic
948399735 2:237674957-237674979 CACTGCCCAGGCTCTCTCTGGGG - Intronic
948674701 2:239590029-239590051 CACTGCACAGGGCCTCTGTGGGG - Intergenic
1171298627 20:24040200-24040222 CACTGGACAGAGCCTCTGCGTGG - Intergenic
1172296866 20:33818385-33818407 CAATGCCCAGATTCCCTCTGTGG + Intronic
1173536767 20:43820750-43820772 GACTCCCCAGATGCTCTGAGTGG - Intergenic
1176309202 21:5140870-5140892 CACTGCCCTGTTCCTCGTTGTGG - Intronic
1177815690 21:25974149-25974171 CAGTGGCCATATTCTCTGTGGGG - Intronic
1179847859 21:44121163-44121185 CACTGCCCTGTTCCTCGTTGTGG + Intronic
1179996780 21:44977837-44977859 CACTTCCCAGACACTCTGAGTGG - Intergenic
1180702570 22:17789603-17789625 AGCTGCCCAGAACCCCTGTGTGG - Exonic
1182311904 22:29415404-29415426 CACTGCACTGATCCTCTGCGGGG + Intronic
1182771028 22:32796597-32796619 CTCTGGCCAGACCCTCAGTGGGG - Intronic
1183304752 22:37076599-37076621 CGCTGCCCACTTGCTCTGTGGGG - Intronic
1183960896 22:41411299-41411321 CCCTGCCCAGTCCCTCTGCGGGG - Intergenic
1185293474 22:50040849-50040871 CTCTGCCCAGCTCCTCTCTCTGG + Intronic
950123067 3:10494702-10494724 CACTGCACAGATTCTCAGAGAGG - Intronic
950247572 3:11435634-11435656 GACTGCCATGTTCCTCTGTGTGG + Intronic
953668713 3:44944891-44944913 CCCTGCCCAGGTCCTATGTCAGG + Intronic
953801883 3:46030997-46031019 CCTTGCCCAGAACCACTGTGGGG + Intergenic
954437116 3:50502306-50502328 CAGTGCCCAGACCCCCTTTGGGG - Intronic
954755952 3:52840091-52840113 CACTGCCCACAGCCACGGTGAGG + Exonic
960205295 3:114890318-114890340 CACTGCCAAGATTCTGTATGAGG - Intronic
961646534 3:128395641-128395663 CACGGCCACGATCCCCTGTGAGG - Intronic
962360884 3:134741851-134741873 CTCAGCCCAGCTCCTCTGAGGGG + Intronic
963606106 3:147412805-147412827 CTCTGCCCAGTTCCACTGAGTGG - Intronic
966869817 3:184283000-184283022 CATGGCCCCGATCCCCTGTGAGG + Intronic
966876873 3:184327414-184327436 CACGGTCCCGATCCTCCGTGAGG - Exonic
967699423 3:192574009-192574031 CACTCCCATGATCCTCTGTTAGG - Intronic
968478419 4:823585-823607 CAGTGCCCAGAACTCCTGTGAGG - Intronic
976715770 4:88121090-88121112 TACTGGCCTGATCCTCTTTGAGG - Intronic
978690208 4:111499448-111499470 CACTGCCAAGATGCTCTCTCTGG + Intergenic
981568948 4:146131539-146131561 CACTGCCCATTTCCTCTGCCTGG + Intergenic
984932572 4:184860068-184860090 CACGCCCCACCTCCTCTGTGCGG - Intergenic
985284089 4:188316903-188316925 CACTGCCTAGCTCCTCAGGGTGG - Intergenic
985334860 4:188881378-188881400 CACTGGCCAATTCCACTGTGAGG - Intergenic
985659105 5:1146957-1146979 CACTGCACAGTCACTCTGTGTGG + Intergenic
985709556 5:1420643-1420665 CACTGCCCTGCTCCTGCGTGGGG - Exonic
990487999 5:56277996-56278018 CACTGCCCAGATCCTTGTTCAGG - Intergenic
990575343 5:57118436-57118458 CACTGTACAGATCCTTTCTGTGG - Intergenic
992911688 5:81401396-81401418 CACTGCCCTGCTCCCCTGGGAGG + Intergenic
993356864 5:86924029-86924051 CAAAGACCAGATCCTCTGTCTGG + Intergenic
995063710 5:107838258-107838280 CACCTCCCAGATCCTCTTTCAGG - Intergenic
995481193 5:112594928-112594950 CACTGCCCAGATCCCCTGCAGGG + Intergenic
996411526 5:123164189-123164211 CACTGTGCAGATGCTGTGTGAGG + Intronic
999640011 5:153663014-153663036 CACTGCCCAGAGCCTTTGGAAGG + Intronic
1006136841 6:31900888-31900910 CACTGACCCCATCCTCTTTGAGG + Exonic
1007079184 6:39086642-39086664 CACTGCCCAGTTTCTTTTTGAGG + Exonic
1007729521 6:43937434-43937456 CACGGCCCAGAGCATGTGTGTGG - Intergenic
1007737261 6:43989652-43989674 CACTGCTCTGCTCCTTTGTGTGG - Intergenic
1007777773 6:44233350-44233372 CCCAGCCCAGAGCCTCTGGGTGG - Intronic
1013007102 6:106083919-106083941 CACTGCTCAGGCCCTCTGGGAGG + Intergenic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1014320607 6:119924216-119924238 CACCCCCAAGATCCACTGTGGGG + Intergenic
1016395785 6:143622041-143622063 CACTGCCCAAGGCCTCAGTGGGG - Intronic
1016620340 6:146102167-146102189 CACTGCCCATATCCTCAATCTGG + Intronic
1017556514 6:155576994-155577016 CAGTGCCTACATCCTCTGTGGGG - Intergenic
1018850952 6:167589686-167589708 CCCTGCCCAAATCCTCTGGGAGG + Intergenic
1019104160 6:169655336-169655358 GGCTGCCCTGATCTTCTGTGCGG - Intronic
1019610763 7:1935567-1935589 CTCTGCCCCGCTCCTTTGTGGGG - Intronic
1020886939 7:13830089-13830111 TGCTGCCCAGAATCTCTGTGGGG - Intergenic
1021190375 7:17613361-17613383 GCCTGCCCAGAATCTCTGTGTGG - Intergenic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1026436797 7:70406232-70406254 CACTCCCCATGTCCTCTGAGAGG - Intronic
1031766266 7:125781494-125781516 CACTGCTCTGCTCCTCTGTCAGG + Intergenic
1035041409 7:155930794-155930816 CACTTCACAGAGCCCCTGTGAGG - Intergenic
1035069013 7:156127383-156127405 CACTGCCCAGAAACGCTGTTAGG - Intergenic
1035222108 7:157411973-157411995 TTCTGCCCGGATCCTCTTTGTGG + Intronic
1035242646 7:157542298-157542320 CAGTGCCCTGAGGCTCTGTGAGG + Intronic
1035276898 7:157753294-157753316 CACAGCACAGTTCCTCTGTGGGG - Intronic
1036654944 8:10671887-10671909 CACTGCCCAGAGTCCCAGTGAGG - Intronic
1038089365 8:24236150-24236172 CACTGCGTTGATCCTCTGCGGGG - Intergenic
1039562268 8:38522193-38522215 AACTCCCCATATCCTGTGTGGGG + Intronic
1039646138 8:39285172-39285194 CACTGCCCAGATCCTGTCATGGG - Intergenic
1041030580 8:53731934-53731956 CACTGCATTGATCCTCCGTGGGG - Intronic
1041699080 8:60767668-60767690 CCCTGCCCAGCAGCTCTGTGCGG + Intronic
1043978726 8:86614167-86614189 CTCTTCCCAGTTCCTCAGTGTGG + Intronic
1045295421 8:100868121-100868143 CCCTGCCCAGATCCTCTTTCTGG - Intergenic
1048198538 8:132352506-132352528 CACTGCCCCGAGCTGCTGTGAGG + Intronic
1048572850 8:135669442-135669464 CTCTGCTCAGCTCCTCTCTGGGG + Intergenic
1049299208 8:141860975-141860997 CCCTGGCCAGGGCCTCTGTGTGG - Intergenic
1051249183 9:15142061-15142083 CACAGCCCATATGCTCTTTGAGG - Intergenic
1052023092 9:23546807-23546829 CACTTCCTATTTCCTCTGTGTGG - Intergenic
1053102366 9:35381570-35381592 CACTGCCCTGAATGTCTGTGAGG - Exonic
1057860680 9:98638435-98638457 CAGTGCCCAGGGCCTCTCTGTGG + Intronic
1060688776 9:125637618-125637640 TACAGGCCAGTTCCTCTGTGGGG + Intronic
1061092688 9:128435513-128435535 CACTGCTCAGGGCCGCTGTGAGG + Intronic
1061910255 9:133718686-133718708 CACTGCGCAGACCTTCTCTGTGG + Intronic
1062141583 9:134961931-134961953 CACAGCCCGGAGCCACTGTGGGG + Intergenic
1062149872 9:135012405-135012427 CTCTTCTCAGATCCTGTGTGTGG + Intergenic
1062303004 9:135886359-135886381 CACTGCCCCACTCCTCAGTGCGG - Intronic
1187077237 X:15947316-15947338 CACTGACCACAGCCTCTGGGGGG - Intergenic
1189234713 X:39478126-39478148 CTCTGGCCAGATCCACTGAGGGG + Intergenic
1189245148 X:39557607-39557629 CATTGCCCACAAGCTCTGTGGGG - Intergenic
1190315573 X:49148435-49148457 CGCTGCATTGATCCTCTGTGGGG + Intergenic
1190322246 X:49186147-49186169 GGATTCCCAGATCCTCTGTGGGG + Intronic
1190434968 X:50415183-50415205 CACTGCCCTGCTGATCTGTGGGG + Intronic
1190786516 X:53656012-53656034 CACTGCGCCCATCCTCTGGGAGG - Intronic
1200757208 Y:7001102-7001124 CCTTGCCTGGATCCTCTGTGGGG + Intronic
1200947733 Y:8863425-8863447 CACTGCCTTGATCCTCTACGGGG - Intergenic