ID: 947581260

View in Genome Browser
Species Human (GRCh38)
Location 2:231320327-231320349
Sequence TGCAAATGGGTCAGCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947581260_947581265 25 Left 947581260 2:231320327-231320349 CCCAAAGGGCTGACCCATTTGCA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 947581265 2:231320375-231320397 CTTTCTTGCTCCCCATCACTTGG 0: 1
1: 0
2: 4
3: 18
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947581260 Original CRISPR TGCAAATGGGTCAGCCCTTT GGG (reversed) Intronic