ID: 947581260

View in Genome Browser
Species Human (GRCh38)
Location 2:231320327-231320349
Sequence TGCAAATGGGTCAGCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947581260_947581265 25 Left 947581260 2:231320327-231320349 CCCAAAGGGCTGACCCATTTGCA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 947581265 2:231320375-231320397 CTTTCTTGCTCCCCATCACTTGG 0: 1
1: 0
2: 4
3: 18
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947581260 Original CRISPR TGCAAATGGGTCAGCCCTTT GGG (reversed) Intronic
905512659 1:38534948-38534970 TCCAAGAGGGTCAGCCCTCTTGG + Intergenic
905610737 1:39348859-39348881 AGCAACTGGCTCAGTCCTTTAGG - Intronic
905840606 1:41174527-41174549 TACAAATGGGCCAAACCTTTGGG + Intronic
911643487 1:100314060-100314082 TGCAAATGGCACAGCCACTTTGG - Intergenic
912226427 1:107739666-107739688 TGTATATTTGTCAGCCCTTTTGG - Intronic
912376166 1:109211754-109211776 GGCCACTGGGTCAACCCTTTAGG - Intergenic
912950416 1:114116798-114116820 AGGAACTGGGTCAGCCATTTGGG - Intronic
915264255 1:154704684-154704706 TGCCATTGGGTCAGTCCTCTAGG + Exonic
915491266 1:156251198-156251220 TGCAGATGGGTCAGCCTCTTTGG - Intronic
922948090 1:229534327-229534349 TGCAAATGGGACACACATTTTGG + Intronic
923808972 1:237291342-237291364 TGCAAATGGAACAGCCACTTTGG + Intronic
1064538613 10:16383808-16383830 TGCAAATAGGTCCTCGCTTTTGG + Intergenic
1065410018 10:25415553-25415575 TGTAAATGGTACAGCCCTTTTGG + Intronic
1067060960 10:43077660-43077682 AGCAAACGGGACAGCCGTTTCGG + Intronic
1068721613 10:60252119-60252141 TGCACAGGTGTCAGCCCCTTTGG - Intronic
1068780531 10:60914881-60914903 TGCACAAGGGTCAGCACCTTTGG - Intronic
1068807859 10:61219916-61219938 TGCAAATGGTACAGCCACTTTGG - Intergenic
1071584890 10:86810501-86810523 TGTAAATGGTGCAGCCATTTTGG - Intronic
1073637736 10:105216806-105216828 TGCAGGTGTTTCAGCCCTTTGGG + Intronic
1076203770 10:128578837-128578859 TGAAAATGCGTCAGGCCTGTAGG + Intergenic
1078023279 11:7672727-7672749 AGGTAATGGGTCAGCCCTGTGGG - Exonic
1079749469 11:24179123-24179145 TCCAGATGGTTCAGCCCTTCTGG + Intergenic
1080508240 11:32940004-32940026 TGCAACTGGGACTGCCCTTGGGG + Intronic
1088267348 11:108000549-108000571 TGCAAGTTGGTCAGCCCATCGGG + Intergenic
1088880908 11:113972619-113972641 TCCAAATGGTTCAGCTCTGTGGG + Intergenic
1088895209 11:114073209-114073231 TGCAGAGGGTTCAGCTCTTTAGG + Intronic
1091356948 11:134944481-134944503 TGCAAATGACTCAGGCCTCTTGG + Intergenic
1091633823 12:2182480-2182502 TGCATATTGGTGAGCCCTGTCGG + Intronic
1091891832 12:4062048-4062070 GGCATATGGGCCAGCCTTTTAGG + Intergenic
1092317495 12:7433443-7433465 TGGAAATGAGTCAGCTCTCTGGG - Exonic
1092323238 12:7501211-7501233 TGGGAATGAGTCAGCTCTTTGGG - Exonic
1093330586 12:17833307-17833329 TGCAAATGGTACAGCCACTTTGG + Intergenic
1098196828 12:68011046-68011068 TGTAAATGGATCAGTCCATTTGG + Intergenic
1099920719 12:88953847-88953869 TTAAAATTGGTCATCCCTTTTGG + Intergenic
1100121372 12:91372929-91372951 TGATAATGGGCAAGCCCTTTTGG - Intergenic
1100938737 12:99701215-99701237 TGCAAGTGGGTTTGCACTTTGGG + Intronic
1101725233 12:107383226-107383248 GGCAAATGGGTAAGGCCTATAGG - Intronic
1106451126 13:29883462-29883484 ATCAAATTGGTCAGCCCATTGGG + Intergenic
1108265772 13:48707230-48707252 TGGCAATGGTTCACCCCTTTCGG + Exonic
1111288374 13:86126942-86126964 TGCAAATGACTCAGGCCTTTGGG - Intergenic
1113797001 13:113064232-113064254 TGCTGATGGGGCAGCTCTTTTGG + Intronic
1113858374 13:113463076-113463098 TGCAAATGGCTAAGTCCATTAGG - Intronic
1115449899 14:33535398-33535420 TGCAAATGTGGCAAACCTTTTGG + Intronic
1115510982 14:34137605-34137627 AGCAAAGGGGTCAGCCCTGGAGG - Intronic
1121487042 14:94324439-94324461 TACAAATGGGTCTGCAGTTTTGG + Intergenic
1128074333 15:64816818-64816840 TGGTAAAGGGTCAGGCCTTTCGG - Intronic
1130995486 15:88901533-88901555 TGCAGGTGGGTCAGCCTTCTTGG - Exonic
1131024327 15:89127174-89127196 TGGAAATGAGTCAGCCATTGTGG + Intronic
1133390715 16:5407838-5407860 TGCACATGGCCCAGGCCTTTGGG + Intergenic
1134887338 16:17805315-17805337 TTCAAATGGAACAGCTCTTTTGG + Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1136774634 16:32865247-32865269 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1136895978 16:33996267-33996289 TGGACTTGGGGCAGCCCTTTGGG - Intergenic
1140384680 16:74525130-74525152 TGAAAATGTGTCAGCTCTCTTGG + Intronic
1141348671 16:83272844-83272866 TGCAGATCAGTCAGCCCTGTGGG + Intronic
1203077061 16_KI270728v1_random:1127383-1127405 TGGACTTGGGGCAGCCCTTTGGG + Intergenic
1142729213 17:1840050-1840072 TGCAAAGGGATCAGCACTTTGGG - Intronic
1143173694 17:4944755-4944777 TGCAAATGGGGCAGGTCTTCCGG - Exonic
1148439914 17:47706611-47706633 TGCAAATGGGCCAGGTCTCTGGG - Intronic
1149187888 17:54022773-54022795 TGCAAATTGTACAACCCTTTTGG + Intergenic
1150960790 17:69910230-69910252 TGAAAATGGGACAGGCCTTTTGG - Intergenic
1160500324 18:79398491-79398513 TGCAAATGGTTCAGAGCTATTGG - Intronic
1161325263 19:3660617-3660639 TGAAAATGGGTCAGTCACTTTGG + Intronic
1162653424 19:12109224-12109246 TATAAATGGCTCAGCCCTTCTGG - Intronic
1164722276 19:30441224-30441246 TGGAAGTGGGCCAGCCCTGTTGG + Intronic
1167535037 19:50044545-50044567 TCCACATGGGTCACCCCTTTGGG + Intronic
924978092 2:196153-196175 AGGAAATGGGTCAGCCCACTGGG + Intergenic
929456419 2:42069244-42069266 TGCAAATAGGTCAGGCTTTGTGG - Intergenic
931503468 2:62897509-62897531 TGCAAATGGTACAACCCCTTTGG - Intronic
932093204 2:68824913-68824935 TGCAAATGGGCAGGCCATTTGGG + Intronic
932680190 2:73818191-73818213 TGCAAAGGGGTAAGGCCTGTGGG + Intergenic
935787101 2:106559271-106559293 TGCAAATGTGGCTGCCCATTGGG + Intergenic
938892041 2:135715508-135715530 AGAAAATGGGTCAGCATTTTGGG - Intronic
939469498 2:142601708-142601730 TGAAACTGGGTGGGCCCTTTTGG + Intergenic
940811578 2:158248847-158248869 TGCATTTAGGTTAGCCCTTTGGG + Intronic
940876840 2:158906367-158906389 TGCAAATGGTACAGCCACTTTGG + Intergenic
943327803 2:186522569-186522591 TACAAATGGTTCAGCCCACTGGG - Intergenic
947581260 2:231320327-231320349 TGCAAATGGGTCAGCCCTTTGGG - Intronic
947685836 2:232083458-232083480 TGCAAAGAGCTCAGGCCTTTAGG - Intronic
948863482 2:240763984-240764006 TGCAGATGGGGCAGCCCTGAGGG - Intronic
1169432160 20:5546362-5546384 TGCAAATAAGCCATCCCTTTAGG + Exonic
1171216369 20:23355522-23355544 TGCAATTGGGTTTGGCCTTTAGG - Intergenic
1171315846 20:24194039-24194061 TGCAAATTGGTCTGCCAATTGGG + Intergenic
1171793657 20:29550012-29550034 AGCTTAGGGGTCAGCCCTTTGGG + Intergenic
1171854815 20:30334376-30334398 AGCTTAGGGGTCAGCCCTTTGGG - Intergenic
1172616454 20:36289229-36289251 TGCAAATGGTACAGCCACTTTGG - Intergenic
1173960837 20:47071437-47071459 TGCAAATGGCACAGCCACTTTGG + Intronic
1174511952 20:51060124-51060146 TGGAAATGGGGCCTCCCTTTTGG + Intergenic
1175035889 20:56001554-56001576 TGGCAATGAGTCAGCCCTTGTGG + Intronic
1175207519 20:57322706-57322728 TGTAAATTGGGCAGCCCTTCTGG + Intergenic
1177734494 21:25072178-25072200 TGCAAATTTTTCAGCCTTTTGGG - Intergenic
1180674895 22:17580478-17580500 TTCAAGTCGGTCAGCCCTTGAGG - Intronic
1182836092 22:33342555-33342577 TGTAAAATGCTCAGCCCTTTAGG - Intronic
949309495 3:2680472-2680494 TGCAAATGGGTAGACACTTTTGG + Intronic
954656240 3:52195930-52195952 TGGAAAAGGCTCAGCCCTGTGGG - Intergenic
959129566 3:102337409-102337431 TGCCTATGGGGTAGCCCTTTGGG + Intronic
959333174 3:105032540-105032562 TGCAAATAGGTCAGCAAGTTTGG + Intergenic
959433261 3:106281999-106282021 TCCAAGTGGGTTAACCCTTTGGG - Intergenic
962658549 3:137575574-137575596 TGTATATGGGTCATTCCTTTTGG + Intergenic
964879652 3:161409512-161409534 TGCAAAATGGTCAGCCCTGAGGG - Intergenic
967151601 3:186655710-186655732 TGCAAATGGTACAGCCACTTTGG + Intergenic
967975357 3:195031332-195031354 GGCAAATGGATCACCCCTTAGGG + Intergenic
973785516 4:54329131-54329153 TTCATATGGGTCTCCCCTTTGGG - Intergenic
978523147 4:109637221-109637243 GGGAAATGTGTCAGCCCTATGGG + Intronic
978983606 4:114982538-114982560 TGCAAATGAGTTAGGCTTTTAGG - Intronic
981130214 4:141150180-141150202 TGCTAATATGTCAGCCCTTTTGG - Intronic
981572542 4:146168111-146168133 TTCAAATGGCTCACCCCTGTTGG + Intergenic
983839590 4:172440056-172440078 TGCAAATGGTACAGCCACTTTGG + Intronic
984007037 4:174324475-174324497 AGCAAATGGGCCAGCCAGTTTGG - Intronic
987590909 5:19924832-19924854 TGCAAATAGATCAACTCTTTAGG + Intronic
988966296 5:36421539-36421561 TTCAACTGGGAGAGCCCTTTAGG + Intergenic
990169359 5:53030518-53030540 TCCATATGGTTCAGCCCTTCAGG - Intronic
993007263 5:82442079-82442101 TGAAAAAGGGTTGGCCCTTTGGG - Intergenic
995016085 5:107310608-107310630 TGTAAATGGGACAGCCATTATGG + Intergenic
996652185 5:125892436-125892458 TGCACATGTATCAGCCCCTTTGG - Intergenic
997638564 5:135433750-135433772 AGGAAATGGGTCAGCCCTGGGGG - Intergenic
998821937 5:146065071-146065093 TGCCATTGTGTCAGACCTTTGGG + Intronic
1000534988 5:162468884-162468906 TGCTTATGGGTCAGGCCTTTTGG + Intergenic
1004729498 6:18344013-18344035 AGCCAATGGGCCACCCCTTTAGG - Intergenic
1004858517 6:19776611-19776633 TGCAAATGGATCTGCCACTTTGG + Intergenic
1006047646 6:31310682-31310704 CTCTTATGGGTCAGCCCTTTGGG - Intronic
1008906738 6:56685848-56685870 TGCAAATAGTTCAGCCCCTGTGG + Intronic
1011830300 6:91363797-91363819 TGCAAATGGCCCAGACCTTCAGG + Intergenic
1015671125 6:135691107-135691129 AGCAAAATGGTAAGCCCTTTTGG - Intergenic
1016022453 6:139250424-139250446 CACAAATGGGTCAGACCTCTTGG + Intronic
1017460735 6:154647104-154647126 TACAAATGGTACAGCCATTTGGG + Intergenic
1021570574 7:22060701-22060723 TGCAAATTGTTCAGCCCCTTTGG + Intergenic
1021621031 7:22551182-22551204 TGTAAAAGGGTTAGCCCTTTTGG - Intronic
1023969281 7:44979210-44979232 TGCAAACGGGTCAGACCGTTAGG - Intergenic
1024702136 7:51915516-51915538 TGCAAATGTGTATGCCTTTTTGG - Intergenic
1032191092 7:129766300-129766322 TGCCAATGGGTCTGCCCTCCTGG - Intergenic
1036978007 8:13436443-13436465 TGAAAACGGGTCAGTCCTTTTGG - Intronic
1039587439 8:38719066-38719088 TGCAAATTACTCAGCACTTTGGG - Intergenic
1039630974 8:39110627-39110649 TGCAAATGGTACAGCCACTTTGG - Intronic
1041888515 8:62841892-62841914 TGTAAATGGTTCAGCCATTATGG - Intronic
1042478779 8:69280259-69280281 AGAAAATGGGGCAGCCATTTGGG + Intergenic
1043939192 8:86177629-86177651 TGCAAATGGTTCAGTGTTTTTGG + Intergenic
1044863793 8:96549470-96549492 TGCAAACTGGGCAGCTCTTTTGG + Intronic
1047315166 8:123726486-123726508 TCCAAGTGGGGTAGCCCTTTTGG + Intronic
1048596356 8:135870906-135870928 TGCAAAACTGTCAGGCCTTTAGG + Intergenic
1051850788 9:21505266-21505288 TACAAATGGCACAGCCATTTGGG + Intergenic
1053729840 9:41042235-41042257 TGCAAATGGAACAGGCATTTTGG + Intergenic
1053792636 9:41697659-41697681 AGCTTAGGGGTCAGCCCTTTGGG - Intergenic
1054152542 9:61617160-61617182 AGCTTAGGGGTCAGCCCTTTTGG + Intergenic
1054181050 9:61909680-61909702 AGCTTAGGGGTCAGCCCTTTGGG - Intergenic
1054472315 9:65548309-65548331 AGCTTAGGGGTCAGCCCTTTGGG + Intergenic
1054656541 9:67671462-67671484 AGCTTAGGGGTCAGCCCTTTGGG + Intergenic
1054698667 9:68389828-68389850 TGCAAATGGAACAGGCATTTTGG - Intronic
1054749815 9:68893936-68893958 TGTAAATTGGTCTGCCATTTTGG + Intronic
1054824575 9:69560017-69560039 TGCGAAAGGGGCAGCCCTTGAGG + Intronic
1055759675 9:79593413-79593435 AGCAAAAGGGTCAGCACTTGTGG + Intronic
1185528199 X:795919-795941 TGCAAATGCTTCTGCCCTGTTGG - Intergenic
1185694609 X:2185943-2185965 GGCAAATGGGTCACCGCCTTTGG + Intergenic
1185694882 X:2187011-2187033 GGCAAATGGGTCACCGCCTTTGG + Intergenic
1185694956 X:2187299-2187321 GGCAAATGGGTCACCGCCTTTGG + Intergenic
1187222370 X:17340579-17340601 TGCCAGTGGGTCAGCCCTACTGG - Intergenic
1192320692 X:70088153-70088175 TGCCAATGTGACAGCTCTTTTGG + Intergenic
1192787568 X:74350052-74350074 TGCACATGGCTCAGCTCATTGGG - Intergenic
1194102577 X:89724278-89724300 TGCAAAATGGTCAGCCACTTTGG - Intergenic
1194378415 X:93164311-93164333 AGCAATTGGAGCAGCCCTTTTGG + Intergenic
1194599089 X:95898355-95898377 AGCACATGGGTTAGACCTTTAGG + Intergenic
1195582374 X:106521969-106521991 TGTAAATTGGTCAGCCATTATGG - Intergenic
1198132542 X:133711626-133711648 TGAAAATAGGTTTGCCCTTTAGG - Intronic
1199996815 X:153030947-153030969 GGCAAATGGGGCAACCCTCTTGG - Intergenic
1200105308 X:153708808-153708830 TGGACTTGGGGCAGCCCTTTGGG - Intronic
1200455163 Y:3381555-3381577 TGCAAAATGGTCAGCCACTTTGG - Intergenic
1201509688 Y:14745369-14745391 TGCAAATAGATCAGACTTTTTGG + Intronic