ID: 947584919

View in Genome Browser
Species Human (GRCh38)
Location 2:231349267-231349289
Sequence AGTCATTTGCAAAACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 4, 2: 17, 3: 50, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947584919 Original CRISPR AGTCATTTGCAAAACATGGA TGG Intronic
904026175 1:27504972-27504994 TGTCCTCTGCAAAACAGGGAAGG - Intergenic
904120826 1:28196701-28196723 ACTAATTTGCAAAACAGGAATGG + Intergenic
905770534 1:40635464-40635486 AGTGTTTTTCAAACCATGGATGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
906987447 1:50699511-50699533 AGAGATTTGCAAAAAATGGTTGG + Intronic
907878919 1:58524541-58524563 AGTCTTTTGCAAAAAGTGCAAGG + Intronic
907985869 1:59529701-59529723 AGGCATTGGCAAATCATTGAAGG + Intronic
908440736 1:64151366-64151388 AGTCATTTGCCAGAGATGAAAGG - Intronic
908466739 1:64403357-64403379 AGTTATTTGCAATGCAGGGATGG + Intergenic
909563603 1:77031161-77031183 ACTCATTTGCTAATCATTGATGG - Intronic
910492641 1:87789463-87789485 ACTCATTTCCACAACATGGCAGG - Intergenic
910545385 1:88410063-88410085 TGTCATTTGCCAAAAATAGAAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911930961 1:103902966-103902988 ATTGATTTGCAAAACAAAGAAGG - Intergenic
911961407 1:104307756-104307778 TGTCACTTGCAAATCATGGATGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915437178 1:155916278-155916300 AGTCATTAGAATATCATGGATGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916383670 1:164242623-164242645 AATCATTTGCAAAACAGTAAAGG + Intergenic
917226713 1:172791174-172791196 ACTCATATGCAAAGCAAGGAAGG + Intergenic
918330284 1:183453544-183453566 AGTCATTTGAAAGAAATGTATGG - Intergenic
918622447 1:186621106-186621128 ATTCTTGTGCAAAACTTGGAGGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918869794 1:189955026-189955048 AGTTAATTGAAAAACATGTAAGG - Intergenic
919135579 1:193504618-193504640 AATCATTTGAAATATATGGATGG - Intergenic
922633104 1:227134200-227134222 AGGTATTTGCAAAACAGTGATGG - Intronic
923141561 1:231164162-231164184 AGTCATTTGACAAACAGGTAAGG + Intronic
923878149 1:238073529-238073551 AATCATTTGAAAAAGTTGGAGGG + Intergenic
923942073 1:238839143-238839165 AGTTAATTGCAAAACATGCATGG - Intergenic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1067221467 10:44347158-44347180 AAACATATGCAAAACATGGCGGG - Intergenic
1067813869 10:49456056-49456078 AGTTAGTTGCAAAATAAGGATGG + Exonic
1068456271 10:57257792-57257814 TATCGTTTGCAAAACATGAAGGG - Intergenic
1069253888 10:66308123-66308145 TTTCATTTGCAAAAAATGCAGGG - Intronic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1070963808 10:80517252-80517274 AGTTATTTGCAAAATAGGCAAGG + Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1073084668 10:100880396-100880418 TGTTATTTGCAGAACAGGGATGG - Intergenic
1073541904 10:104321751-104321773 ACCCATCTGCAAAACAGGGATGG - Intronic
1074683760 10:115938690-115938712 AGTCATTTGCAACACATGAATGG + Intronic
1075138640 10:119810983-119811005 ACTTATTTGCCAGACATGGAGGG + Intronic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1075471178 10:122690819-122690841 AGTAATTTCCAAAACATAAATGG + Intergenic
1075996080 10:126877305-126877327 AGACAGATGCCAAACATGGAAGG + Intergenic
1076623330 10:131806880-131806902 AGTCATTTTGAAAACATTAAGGG - Intergenic
1078417111 11:11174863-11174885 AGTGATTTTCCCAACATGGAAGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079461743 11:20686559-20686581 AGTGATGTACAAAAAATGGAAGG + Intronic
1081555077 11:44151637-44151659 ATTCATATACAAAACATAGAAGG - Intronic
1081568975 11:44278059-44278081 AGGAAGTTGCAAAACAGGGATGG - Intronic
1081826638 11:46060166-46060188 TGACTTTTTCAAAACATGGATGG + Intronic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083919717 11:65775775-65775797 AGTCATTTCCAAATCAGGAAGGG - Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085024870 11:73230492-73230514 AGTCATTTGCATAAAATGTCTGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085667258 11:78425550-78425572 AATCATTTTGAAAACATGCATGG - Intergenic
1085753865 11:79187818-79187840 AGCCATTTGCAAGCCAAGGAAGG + Intronic
1086396083 11:86416464-86416486 AGTTATTTCCTAAACTTGGAGGG + Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088461670 11:110090091-110090113 AGAGATTTGCAAAACAAGCAAGG - Intergenic
1088714670 11:112538484-112538506 AGTAATTTGGAATACCTGGAGGG + Intergenic
1089003695 11:115073327-115073349 AGACATTTGCAAGACAAGAAGGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090441211 11:126727140-126727162 AGTCATTTCATGAACATGGATGG - Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092660786 12:10735825-10735847 ATTCTTTTCCCAAACATGGATGG + Intergenic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1094179566 12:27577406-27577428 ATGCATTTGTAAAACATGTATGG + Intronic
1094628161 12:32145974-32145996 AGTGATGAGCAAAACAGGGATGG + Intronic
1095050567 12:37550614-37550636 ATTTATTTGCAATACATGAATGG - Intergenic
1095367631 12:41427049-41427071 AAACATTTGCAGAACTTGGATGG + Intronic
1095585945 12:43849202-43849224 GGTCATTTTCCAAAAATGGATGG + Intronic
1097414616 12:59299226-59299248 AGTCACTTGCAAAAGATTCAAGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097579949 12:61443001-61443023 AGTCATATGCACAACAGGTAAGG + Intergenic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1098140711 12:67447802-67447824 ATTCATTTGAAAAACAAGGGAGG + Intergenic
1098735886 12:74103852-74103874 AGACAATGGCAAAATATGGAAGG - Intergenic
1098843259 12:75503229-75503251 TGTCATATGCTAAACATGGGAGG + Exonic
1099374867 12:81886782-81886804 AGTCCTTTACAAGACATGCAAGG - Intergenic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1100268521 12:93001355-93001377 TGTCATTTGCAAAACAGAGATGG - Intergenic
1101268420 12:103116521-103116543 AGACATTTGGGAAACATGGCAGG - Intergenic
1102267011 12:111494807-111494829 AATCACTTTCAAAACAAGGAAGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103667729 12:122583522-122583544 AGTCATTTGAAAAACAGGCTGGG + Intronic
1106338391 13:28805560-28805582 AGGCAGTTGTAGAACATGGAAGG - Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1108255385 13:48604745-48604767 TGTCATCTGCACAACATGGTTGG - Intergenic
1108462152 13:50677408-50677430 AGTCCTGTGCAAAAAATGCAAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110334322 13:74309109-74309131 AGCCATTTGCAAGCCAAGGAAGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111569200 13:90057747-90057769 AGTTTTTTGAGAAACATGGATGG - Intergenic
1111882071 13:93969874-93969896 TGTCATTTGCGCAACGTGGATGG - Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115656949 14:35452358-35452380 AGTCATTTACAACAACTGGATGG - Intergenic
1115731039 14:36270404-36270426 AGTCATAGGCAAAACTTAGAAGG + Intergenic
1116029040 14:39549018-39549040 AGTAACTTGGAATACATGGAAGG - Intergenic
1116034204 14:39608426-39608448 TGTCATCTGCAACACATGTATGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117042915 14:51783908-51783930 ACTCATTTGGAGAAGATGGACGG + Intergenic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118438204 14:65790256-65790278 AGTCATTTGCTGAACATGCAGGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120378639 14:83744179-83744201 AGTCATTTTCAAGACATGCTAGG - Intergenic
1120900650 14:89572866-89572888 ACTCATTTGCATGGCATGGAAGG - Intronic
1124154699 15:27215629-27215651 ACACATTTGCAAAACTTGCATGG + Intronic
1124927490 15:34085262-34085284 AGTCATTGGCAAAACAGGATAGG + Intronic
1128241207 15:66102186-66102208 AATCCTTTGCAAAGCAAGGAAGG - Intronic
1130943406 15:88530971-88530993 AGTCACCTGGAAGACATGGATGG + Exonic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132382862 15:101378835-101378857 AGTCCTTTTCACACCATGGATGG + Intronic
1134867659 16:17622655-17622677 TGTAATTTGCAAAACACAGAAGG - Intergenic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1138872977 16:60915075-60915097 TTTCCTTTGCAAAACATAGAGGG + Intergenic
1139134568 16:64186376-64186398 AATCTTTTGCAGAAAATGGATGG - Intergenic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1141883005 16:86872254-86872276 AGCCATTTGCTAAATGTGGAAGG - Intergenic
1144286097 17:13776198-13776220 AGTCATTTGTACAACAAGGAAGG + Intergenic
1145822382 17:27849065-27849087 ATTCATTTGGAAATCAGGGATGG + Intronic
1145995015 17:29100069-29100091 AGTCATTGGTCAAACAGGGAGGG + Intronic
1146591295 17:34130111-34130133 ATTCATTTGCACATCATGAAAGG + Intronic
1146699495 17:34943953-34943975 ATTCATTTACAAAACATTCAGGG + Intronic
1147996195 17:44361759-44361781 GTTCATTTGTAAGACATGGAAGG - Intronic
1153821116 18:8832806-8832828 AGTCCTTAGGAAAAGATGGAGGG - Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1154246508 18:12703810-12703832 AGTAGTATGCAAAAGATGGAGGG + Intronic
1154461018 18:14586252-14586274 TGTTATTTGCAAAGCATGGATGG + Intergenic
1155394404 18:25371591-25371613 AATCACCTGCAAAACTTGGACGG - Intergenic
1155869413 18:31007027-31007049 AGTCATTTGCAAACCAAAAATGG - Exonic
1156604405 18:38649132-38649154 AGTCCTTTGGAAAACATAAAGGG - Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159231783 18:65617389-65617411 AAACTATTGCAAAACATGGAGGG - Intergenic
1159534056 18:69692696-69692718 AGTCACAGGCAAAACTTGGATGG - Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160379957 18:78446599-78446621 AGGCATTTGCAAAACAGGCGGGG + Intergenic
1162475489 19:10896928-10896950 CTTCATTTGCAAAACCCGGAAGG - Intronic
1164254075 19:23512011-23512033 TGTAATTTGCAATTCATGGAAGG - Intergenic
1164499396 19:28802831-28802853 AGCCATATGCAAAAGATTGATGG + Intergenic
1166736191 19:45086512-45086534 AGACATGTGCCAAACATGGTAGG + Intronic
925063967 2:914893-914915 AGTCATTGGGAGAGCATGGACGG - Intergenic
925063985 2:914979-915001 AGTCATTGGGAGAGCATGGACGG - Intergenic
926304206 2:11626284-11626306 GGTCATTTGAAAAACAAGCAGGG + Intronic
927746029 2:25622113-25622135 ACTCATTTGTAAAACATAAATGG + Intronic
928192559 2:29186321-29186343 AGGCATTTCTAAAGCATGGAAGG + Intronic
928271529 2:29859494-29859516 AGACAGTTCCAAAAAATGGAGGG + Intronic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
928863510 2:35889523-35889545 TGTCACTTGCAACAAATGGATGG - Intergenic
929364067 2:41130260-41130282 AGTCACGTGCAAAACAAGGTAGG - Intergenic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933549444 2:83756867-83756889 AGTCATTTGAAATAAATGAAAGG - Intergenic
933979381 2:87538054-87538076 ACCCATTTGCAAATCAAGGATGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
936314444 2:111412737-111412759 ACCCATTTGCAAATCAAGGATGG + Intergenic
936879210 2:117230015-117230037 AGAGACTTGCCAAACATGGAAGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
939409347 2:141804116-141804138 TGTCATTTGAAAATTATGGAAGG - Intronic
940346442 2:152633814-152633836 TGTCATTTGAAAAACATCGGTGG + Intronic
941648929 2:168072172-168072194 TGTCATTTTTAAAACATGAATGG - Intronic
942330834 2:174822135-174822157 ACTCATTTTGAAAACACGGAGGG - Intronic
942937001 2:181569420-181569442 AGGCATTTCCAAGAAATGGAAGG + Intronic
943221247 2:185109207-185109229 AGTAAATTGAAAAACATGGATGG + Intergenic
943484230 2:188458997-188459019 AGTCATTTGCAACAAATGGATGG - Intronic
943926284 2:193785258-193785280 TGTCAATTAAAAAACATGGATGG + Intergenic
946479736 2:220043001-220043023 ACTCATTGACAAAACATGGGGGG - Intergenic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
947906608 2:233768370-233768392 AGTCATTTCCAGAACATTCAGGG - Exonic
948019049 2:234715275-234715297 GGTCATCTTCAAAACATGGATGG + Intergenic
1170507384 20:17041436-17041458 AGTCATTTCTATAACATGCAAGG + Intergenic
1170598071 20:17820428-17820450 TGTCATTTTTCAAACATGGAAGG + Intergenic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171335668 20:24383180-24383202 AGTCATTTGCTAAAGATGTCAGG - Intergenic
1173178673 20:40785124-40785146 AGTCATTTGCAACAACAGGATGG - Intergenic
1176813484 21:13571588-13571610 TGTTATTTGCAAAGCATGGATGG - Intergenic
1176991289 21:15499802-15499824 AGTCATCTGCAAAAAATAGTAGG - Intergenic
1177168437 21:17628904-17628926 AGTCATATCCACAGCATGGAGGG + Intergenic
1177460791 21:21407058-21407080 AGTCATTTTCAAAATCAGGAAGG - Intronic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1178122215 21:29480722-29480744 AATAAGTTGCAAAATATGGAAGG - Intronic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1181893121 22:26082380-26082402 ACTCATTTGTTAAATATGGATGG - Intergenic
1184292562 22:43505886-43505908 AGTCATTTCCCAAACATGACAGG - Exonic
949506365 3:4731799-4731821 AGGCATTTGCAAAACAAGATGGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950953877 3:17029910-17029932 TGTCCTTTGCAAAACATGCCAGG - Intronic
952538818 3:34344669-34344691 AGTCATTTGCAACAACTGGAAGG + Intergenic
953207572 3:40845306-40845328 AGTCATTTACAAAAAATGTTTGG - Intergenic
953976952 3:47389228-47389250 AGTTATTTCCCAAACAGGGAAGG - Intronic
955237891 3:57156016-57156038 AGTCATTTAAGAAACATGTATGG + Intronic
955923675 3:63984637-63984659 AGTCATTTACAAAGCGTGGCAGG + Intronic
956525325 3:70153210-70153232 AGTCATTTAAAAAACTTGGGCGG - Intergenic
956531757 3:70227767-70227789 CCTCATTTGTAAAACATGGAGGG - Intergenic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
957594828 3:82250007-82250029 AGTAATCTCCAAAACATGTAAGG - Intergenic
959414621 3:106069000-106069022 ACTCAGTTGCAACACATAGAAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960920476 3:122741936-122741958 AGACATTTGGAAAACATGGGTGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964904622 3:161704680-161704702 AGTCATTTGCAAAACATAGGTGG + Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
966525769 3:180917577-180917599 AGATAGTTGCAAAACGTGGAGGG + Intronic
967585606 3:191210696-191210718 AGTCATTTGGAAAACCTGCTGGG - Intronic
967726612 3:192868232-192868254 AGTCATATCCAAAAGATAGAAGG + Intronic
968909271 4:3469360-3469382 AGGCTTTTGCAGAACTTGGAGGG - Intronic
969964179 4:10977020-10977042 ATTCATCTGCAAAACACAGAGGG + Intergenic
970255221 4:14161266-14161288 AAACATTTGCAAAAGATAGATGG - Intergenic
970359730 4:15296948-15296970 AAACATTTGCAAAAAATGTAGGG + Intergenic
970671312 4:18399750-18399772 ATTCATATACAAAACTTGGAAGG + Intergenic
971521034 4:27550663-27550685 CATCATTTGCACAACATAGAAGG + Intergenic
971735588 4:30445593-30445615 ATTCATTTCCAAAATATGGAAGG + Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
972408627 4:38769255-38769277 AGTCATTTTTAAAACATGATCGG + Intergenic
972855860 4:43105743-43105765 AGTCATCTGCAAGCCAAGGAGGG + Intergenic
973170776 4:47140566-47140588 AGTGACATGCAAAACATGGTGGG + Intronic
974337151 4:60563968-60563990 AGTCATTTGTACAACATGGATGG - Intergenic
975365757 4:73525573-73525595 AATCATCTGCAAGTCATGGAAGG - Intergenic
975752366 4:77537251-77537273 AGTCATTGGCTAAACCTGGAGGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976901458 4:90181899-90181921 AGTCATTTGGTAAACATCTAAGG + Intronic
977186848 4:93949773-93949795 AGTTCTTTGCACAACATAGATGG + Intergenic
979268105 4:118726845-118726867 AGTAATTAGCATAACCTGGAAGG + Intronic
979571730 4:122235157-122235179 AGTCATGTGCAAAACAAAGGTGG - Intronic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981930698 4:150185925-150185947 ATTCATTTGGAAAACTTAGATGG + Intronic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983228226 4:165105069-165105091 AATGCTTTGAAAAACATGGAGGG - Intronic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
986790674 5:11156586-11156608 AGTCATTGGCAAAAGAAGAAAGG + Intronic
987015207 5:13810918-13810940 TGTCATTTGAACAACATGAATGG + Intronic
987433836 5:17868705-17868727 AGTCATTTCAACAACATGGATGG - Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988288166 5:29249230-29249252 AGCCAGTTGAAAAACATGGTGGG - Intergenic
988364602 5:30280076-30280098 AGTCATTGCAACAACATGGATGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
989606717 5:43251459-43251481 CCTCGTTTGTAAAACATGGAAGG - Intronic
989842484 5:46096799-46096821 ATTCATTTGAAAAATATTGAGGG + Intergenic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
991394737 5:66192208-66192230 AGACATTTGCATTAAATGGATGG + Intergenic
992441787 5:76803461-76803483 ACTCATTGTCAAAACAGGGAGGG + Intergenic
993057926 5:83003736-83003758 TGTCACATGCACAACATGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993396855 5:87400184-87400206 AGTCATTTGGATCACATGGCTGG - Intronic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993811035 5:92476179-92476201 AGTCACTTGCAAAATAATGAGGG - Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995190179 5:109311374-109311396 ATTCATTTGGAAAACATTTAAGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
998675691 5:144405394-144405416 AGTAATTTGCCAAACATTGCAGG - Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001169088 5:169400920-169400942 AGTTATTGGCATAATATGGATGG + Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002949252 6:1792710-1792732 AGTCATTTCCAAAATTTAGAGGG + Intronic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004065685 6:12241565-12241587 AGTTATTTGCAAAAAAAGTACGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1010601389 6:77831595-77831617 CATCATTTGCAGAGCATGGATGG + Intronic
1010829029 6:80508429-80508451 AGTCAGTAGCAAATCATGGAAGG - Intergenic
1010899283 6:81406066-81406088 AGTCTTTTGAAAAATATGGCAGG + Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1013841742 6:114404312-114404334 ATTCAATTGCAAACCTTGGAAGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1015681348 6:135812200-135812222 ACACATTTGCCAAATATGGAGGG + Intergenic
1016929259 6:149387015-149387037 AGAAAATTGCAAATCATGGAAGG - Intronic
1017435128 6:154408458-154408480 AGTACATTGAAAAACATGGAAGG - Intronic
1018063196 6:160106314-160106336 AGTCATTCACTAAACATGGCAGG - Exonic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1019390005 7:781327-781349 AGTCATTGGATCAACATGGAGGG - Intronic
1020913921 7:14168645-14168667 AGACATTTGCAAAGTATGAAGGG + Intronic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1024404744 7:48965131-48965153 AGTCAATAGCAAATCATGGTTGG + Intergenic
1024549769 7:50552969-50552991 AGTCAAGTGCTGAACATGGAGGG - Intronic
1024899300 7:54299451-54299473 AACAATTTGTAAAACATGGAGGG - Intergenic
1025114705 7:56247767-56247789 TATCATTTGTAAAACATGGAGGG - Intergenic
1025296489 7:57779157-57779179 ATTTATTTGCAATACATGAATGG - Intergenic
1025746263 7:64245683-64245705 AGTCATCAGCAAAAAATGCAAGG + Intronic
1026669140 7:72372051-72372073 AGGTATTAGCAAAACAGGGAAGG + Intronic
1027740280 7:81993820-81993842 AGTAATTTGCAATAAATTGAAGG + Intronic
1028260063 7:88653003-88653025 AGTCATTTCAACAACATGAATGG + Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032313692 7:130814071-130814093 TCTCATTTGCAAAACATTAATGG - Intergenic
1033513623 7:142084906-142084928 AGTCATGTGAAAGAAATGGAAGG - Intronic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1037188942 8:16099043-16099065 AATCACTTGCAAAAAAAGGAAGG + Intergenic
1038302064 8:26361317-26361339 AGTTATTTGCTAAACATAAAGGG + Intronic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1038943682 8:32333472-32333494 AAATATTTGTAAAACATGGATGG + Intronic
1038957378 8:32482463-32482485 AGTGATGTGCAAAGAATGGATGG - Intronic
1039139482 8:34369846-34369868 AGTAATTTTCAAAACAGGGTTGG + Intergenic
1039362918 8:36899767-36899789 AGTTTTCTGCACAACATGGAAGG + Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043290500 8:78594382-78594404 AGTCCTTTCCAGATCATGGAAGG + Intronic
1043377421 8:79666451-79666473 AGCCCTTTTCAAAACATTGAAGG + Intergenic
1043557394 8:81447697-81447719 AGTCTTTTCCAAAGCATGAAGGG - Intergenic
1044337635 8:91006275-91006297 AGTCACATGCTAAACATGGGAGG - Intronic
1044849073 8:96409982-96410004 AGTGATTTGCAAACAATAGACGG + Intergenic
1045116139 8:98982473-98982495 ACTCATTTGTAAAACAGGGAGGG - Intergenic
1046350559 8:113005167-113005189 AGTCATTTGGTAAACCTAGAAGG + Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048632548 8:136259917-136259939 ACTAACTTGCAAAACATGGGTGG - Intergenic
1048838350 8:138543175-138543197 CGTCATTTGAAAAACATGCAAGG + Intergenic
1050045238 9:1536767-1536789 AAGTATTTACAAAACATGGAAGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051506728 9:17835151-17835173 AGACATTTTCAAATCATGGAAGG - Intergenic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1054711538 9:68516051-68516073 TCTTATTTGTAAAACATGGATGG - Intronic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1057980406 9:99655852-99655874 TGTCATTTGTGCAACATGGATGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1185732181 X:2470084-2470106 TGCCATTTGCGCAACATGGATGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1187881266 X:23849536-23849558 AGTCAACTCCAAAAGATGGAAGG + Intronic
1188229119 X:27639127-27639149 AGTCATTTCAACAACATGGATGG + Intronic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188411667 X:29880009-29880031 ATTCAGTTGCAAAGCTTGGATGG + Intronic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188698074 X:33222010-33222032 ATTCTTTTCCAGAACATGGAAGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192471277 X:71400909-71400931 ACTCATTTGCAAAACTGAGATGG + Intronic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194166113 X:90519186-90519208 AGTCATTTGTGAAACATGGGTGG + Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1195208823 X:102630766-102630788 GGTCATTTGTAAACCAGGGAAGG + Intergenic
1195304783 X:103570852-103570874 AGTCATTTCCAAAACACAGAAGG - Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1196000822 X:110783814-110783836 AATGATTGGCAAAACATTGATGG - Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196800321 X:119537362-119537384 ACTCATTTCTAAAACAAGGATGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198714201 X:139538898-139538920 AGCTATCTGGAAAACATGGAGGG + Intronic
1198967213 X:142240148-142240170 AGTATTTTGGAAACCATGGAAGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199064546 X:143399551-143399573 AGACAGTTGCAGAACATGGGAGG - Intergenic
1199669841 X:150135212-150135234 CGTCTTTTGCAAAATTTGGAGGG - Intergenic
1200512383 Y:4096951-4096973 AGTCATTTGTGAAACATGGGTGG + Intergenic