ID: 947586228

View in Genome Browser
Species Human (GRCh38)
Location 2:231358538-231358560
Sequence ACCTGTGGGGAGCGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947586228_947586234 8 Left 947586228 2:231358538-231358560 CCCAGGCAGCGCTCCCCACAGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 947586234 2:231358569-231358591 ACACAGCTCGCTGCTGAGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 128
947586228_947586236 19 Left 947586228 2:231358538-231358560 CCCAGGCAGCGCTCCCCACAGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 947586236 2:231358580-231358602 TGCTGAGTCTGGCCTGTGCTGGG 0: 1
1: 0
2: 4
3: 24
4: 299
947586228_947586235 18 Left 947586228 2:231358538-231358560 CCCAGGCAGCGCTCCCCACAGGT 0: 1
1: 0
2: 1
3: 17
4: 154
Right 947586235 2:231358579-231358601 CTGCTGAGTCTGGCCTGTGCTGG 0: 1
1: 0
2: 0
3: 34
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947586228 Original CRISPR ACCTGTGGGGAGCGCTGCCT GGG (reversed) Intronic
900403004 1:2480316-2480338 AGCTGGGGGGAGCCCTACCTGGG + Intronic
900547595 1:3237233-3237255 GCCTGGGGGGAGCTCTGCCATGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901021794 1:6259855-6259877 CACTGTGGGGAGCCCAGCCTGGG - Intronic
902209186 1:14892528-14892550 ACCTGTGGGGTGGGCTCCCATGG - Intronic
903961240 1:27059095-27059117 CCCTGTGGGGAGCCCTGCCAAGG - Intergenic
904606868 1:31702796-31702818 ACCTATGGGGAAAGCTTCCTTGG - Intronic
904617496 1:31757870-31757892 ACCTGTTGGGAGCTCAGCTTAGG - Intronic
905319522 1:37105963-37105985 GCCTGTGGGGAGGGCTGGATAGG - Intergenic
905886968 1:41496708-41496730 AACTGCGGGGAGGGCTGCCCAGG + Intergenic
906781611 1:48577653-48577675 GCCTGTTGTGAGCCCTGCCTTGG - Intronic
906968858 1:50489237-50489259 ACCTGTGCTGAGCACTGCCAGGG - Intronic
916079455 1:161223408-161223430 AACAGTGGGGAGGGCGGCCTAGG + Exonic
920215570 1:204359744-204359766 AGCTGGGGGGAGGGGTGCCTTGG - Exonic
923113919 1:230916484-230916506 AGCTGTGGGGAGCGTAACCTGGG - Intronic
1062813248 10:481068-481090 ACGTCTAGGAAGCGCTGCCTTGG + Intronic
1063387603 10:5625876-5625898 TCCAGTGGGGAGCCCTGCATGGG + Intergenic
1065605448 10:27413713-27413735 CCCTGTGGGGAGCCCGGCCAAGG - Exonic
1067225691 10:44374416-44374438 AGCTGTTGGGTGGGCTGCCTGGG - Intronic
1068007041 10:51403686-51403708 CCCTGTGGGGAGCTCTGTCTTGG - Intronic
1068226115 10:54108696-54108718 ACCTGTGAGTTGTGCTGCCTGGG - Intronic
1070768677 10:79070208-79070230 AACAGTGGGGAGCGCGGCCTCGG + Intronic
1073439038 10:103541567-103541589 AGCTGTGGGAAGCATTGCCTTGG + Intronic
1076035203 10:127194802-127194824 ACTTTGGGGGAGCCCTGCCTTGG - Intronic
1076307695 10:129476535-129476557 TCCTGGGGGAACCGCTGCCTGGG + Intronic
1076594471 10:131617397-131617419 ACCAGTGGGGAGGGCTGACCAGG - Intergenic
1077220093 11:1411915-1411937 TCCTGTGGGGAACGTGGCCTTGG + Intronic
1077432998 11:2525327-2525349 CCCTGTGGGGAGCCCTCCGTAGG - Intronic
1078447082 11:11412434-11412456 ACCTGTGTGAAGCGGTGGCTTGG - Intronic
1079114632 11:17633620-17633642 CTCAGTGGGGAGCCCTGCCTGGG + Intronic
1079537435 11:21531761-21531783 GCCTGTAGGGAGTGCTGACTGGG + Intronic
1081765374 11:45606625-45606647 ACCTGAGGGCCGTGCTGCCTTGG + Intergenic
1083301087 11:61739919-61739941 ACCAGTGGGGAGAGCTGCCCTGG - Intronic
1084476165 11:69390941-69390963 TCCTGTCTGGAGAGCTGCCTAGG + Intergenic
1085510571 11:77086084-77086106 GCCTGTGGAGAGCCATGCCTGGG + Intronic
1085705837 11:78786312-78786334 GCCTGTGGGGAGCTCTCCCCAGG + Intronic
1086243232 11:84720915-84720937 CACTGTGGGGAGCGCTGGCCGGG + Intronic
1087168077 11:95024113-95024135 AACTGTGGGGACAGCTGCTTTGG - Intergenic
1087401086 11:97667482-97667504 ACTGGTGGGCAGCTCTGCCTGGG + Intergenic
1089046315 11:115504269-115504291 ACCTGTGGGGATCAGTGCCGCGG + Exonic
1089354976 11:117843671-117843693 GCCTGTGGGAAGAGCTGACTTGG - Intronic
1091857495 12:3751529-3751551 TCCGGTGAGGAGTGCTGCCTGGG - Intronic
1092192925 12:6533613-6533635 ACCTGTGGGCTGTGCTGCCTAGG - Intergenic
1102812678 12:115837977-115837999 ACATGTGGGGGGCGCTGCCCAGG - Intergenic
1104676927 12:130717314-130717336 ACCCGTGGTGAGCCCTTCCTTGG - Intergenic
1104801169 12:131556073-131556095 GCCTGTGTGGAGTGCTGGCTCGG + Intergenic
1108518490 13:51223602-51223624 CCCTGTGGGGAGCTTTGCCGGGG - Intronic
1110464958 13:75789973-75789995 ATGTGTGGGGAGGGCTGGCTTGG + Intronic
1113560858 13:111279527-111279549 GCGTCTGGGCAGCGCTGCCTGGG - Intronic
1113660887 13:112105649-112105671 GCCTGGGTGGAGCGCGGCCTCGG + Intergenic
1113800444 13:113083590-113083612 GCCTGGGGGCGGCGCTGCCTAGG + Intronic
1114515624 14:23298040-23298062 ACAGGTGTGGAGCGCTGGCTAGG + Exonic
1115925199 14:38425442-38425464 AGCTGTGGGCTGCACTGCCTGGG + Intergenic
1117434852 14:55706096-55706118 ACCTGCGATGAGGGCTGCCTGGG + Intergenic
1122804399 14:104249322-104249344 AGCTGTGGAGAGGGCGGCCTGGG - Intergenic
1124377598 15:29138366-29138388 ACCTGTGGCGTGAGATGCCTGGG + Intronic
1125189077 15:36968454-36968476 AGCTGTGTTGAGAGCTGCCTAGG + Intronic
1125543885 15:40488561-40488583 ACCTGGGGGTAAGGCTGCCTAGG - Intergenic
1126979899 15:54228797-54228819 ACCTGTGAGCTGTGCTGCCTGGG + Intronic
1127616422 15:60690470-60690492 ACCTGTGAGCAGAGCTTCCTTGG + Intronic
1129002997 15:72349555-72349577 GCCTGTGAGGAGAGCAGCCTTGG - Intronic
1132553615 16:563599-563621 ACCTGTGGGCCGTGCTCCCTGGG - Exonic
1132852502 16:2031170-2031192 CCCTGTGGGGAGCCCAGCCTGGG + Intronic
1137841338 16:51643392-51643414 ACCTGTGTGCAGGGATGCCTAGG + Intergenic
1138520404 16:57567792-57567814 CCCAGTGGGTAGTGCTGCCTGGG + Intronic
1139193512 16:64892061-64892083 ACTTGTGGGGTCCGCTGGCTTGG - Intergenic
1139339234 16:66257128-66257150 AGGTGTGGTGAGGGCTGCCTGGG - Intergenic
1139356730 16:66371279-66371301 AGCGGTGGGGAGAGCTGCCCAGG + Intronic
1139488207 16:67271244-67271266 CCCTGTGGGAAGTGCTCCCTGGG + Exonic
1142007505 16:87696525-87696547 AGCTGCGGGGGGCTCTGCCTGGG - Intronic
1142151265 16:88513505-88513527 TCCTGTGGCCAGGGCTGCCTGGG - Intronic
1142189157 16:88709643-88709665 GCCTGTGGGGAGGGGTGCCGGGG + Intronic
1142613846 17:1123983-1124005 ACCTGTGGGAAGGGCTGGCGGGG - Intronic
1144944247 17:18961691-18961713 AGCTGTGGGCAGGGCTACCTGGG + Intronic
1146516793 17:33495746-33495768 AACTGTGGGGAGGCCTGCCATGG + Intronic
1147119909 17:38329851-38329873 CCCTGTGGTCAGCGCTGCCCAGG + Exonic
1148854624 17:50571983-50572005 AGCTGTGGGCAGGGCTGCTTCGG + Exonic
1151553866 17:74836880-74836902 ACCTGGTGGGAGAGCTGCCCGGG - Exonic
1152135754 17:78502392-78502414 ACTCGTGGGGAGAGGTGCCTGGG + Intronic
1158189334 18:54808256-54808278 ACCTGTGGGGACTGCTGCCCTGG - Intronic
1158642930 18:59219308-59219330 ACAAGTGGGCAGAGCTGCCTGGG + Intergenic
1160378096 18:78429361-78429383 GCCAGTGGGGAGGGCTGCGTGGG - Intergenic
1161460790 19:4396107-4396129 ACCTGTGGGGCGGGGTGCCATGG + Intronic
1161924885 19:7293321-7293343 ACCGGTGGGTGACGCTGCCTGGG - Intronic
1162131665 19:8529882-8529904 ACCTGTGGGCAGGTGTGCCTGGG + Intronic
1162144855 19:8607402-8607424 ACCTGCGGGGCGGGCTGGCTTGG - Intronic
1163116634 19:15192518-15192540 ACCTGTGGGCAGAGATGGCTTGG + Exonic
1164632017 19:29768203-29768225 CCCTGTGGGGAGGGCAGCCTGGG + Intergenic
1165123515 19:33578645-33578667 TCCTCTGGGGAGAGCTGGCTGGG + Intergenic
1166094637 19:40531032-40531054 ACTTTTGGGGGGCTCTGCCTTGG + Intronic
1167244463 19:48365160-48365182 TCGTGTGGGGAGGGCTGCCAGGG - Intronic
1167692594 19:50995965-50995987 CCCTGTGGGGAGGGCTGGATGGG - Intergenic
925290704 2:2746670-2746692 AGCTGTGAGGAGTGCTGGCTGGG + Intergenic
925414728 2:3661407-3661429 GCCTGTGGGGGCTGCTGCCTGGG + Intronic
926906839 2:17813809-17813831 AGCTGTGGGGGCCGCTGCCATGG - Intergenic
929786953 2:45000380-45000402 CCCGCTGGGGAGCGCTGTCTCGG - Intergenic
936947310 2:117942153-117942175 ACCCATGGGGAGCGTAGCCTTGG - Intronic
937979480 2:127606488-127606510 ACCTGTGTGGAGCAGTTCCTTGG + Intronic
942414545 2:175745271-175745293 TCCTGTGGGAAATGCTGCCTTGG + Intergenic
946292166 2:218753663-218753685 AGCTGGGGTGAGTGCTGCCTGGG + Exonic
946503240 2:220272055-220272077 ACGTGTGGGTAGCCCTGCCTTGG - Intergenic
946792902 2:223319550-223319572 ACCAGTGGGCAGCTCTGCCAAGG - Intergenic
947586228 2:231358538-231358560 ACCTGTGGGGAGCGCTGCCTGGG - Intronic
948166298 2:235865346-235865368 ACCTGTGTGTGGCGCAGCCTTGG + Intronic
948620904 2:239233743-239233765 AACAGTGGGGAGGGCTGCCCGGG + Intronic
948840319 2:240645502-240645524 CCCTGCTGGGAGCGCAGCCTGGG + Intergenic
1169438048 20:5610934-5610956 GCCTGGGGGGAGCGCTGGCGAGG - Exonic
1170567913 20:17617075-17617097 ACCGGAGGGGAGCCCTCCCTGGG + Intronic
1170568061 20:17617679-17617701 ACCAGAGGGCAGTGCTGCCTAGG - Intronic
1176081210 20:63273957-63273979 ACCTGTGGGGAGAGGTGCCCTGG - Intronic
1180556538 22:16582610-16582632 ACCTGTGGTGTGCACTGCCGTGG - Intergenic
1180595687 22:16971750-16971772 GCCTGTGGGGAGCTGTTCCTTGG + Intronic
1183629752 22:39025910-39025932 GGCTGTGGGGAGGGCAGCCTCGG - Intronic
1183725599 22:39587548-39587570 ACCTGTGGCCACAGCTGCCTCGG - Intronic
1184058214 22:42066594-42066616 ACCTGTGGTGAGAGCAGCCCTGG + Intronic
956054167 3:65280859-65280881 ACCTATGGGGATCCCTGTCTTGG + Intergenic
956549431 3:70441724-70441746 ACCTGTGAGCTGTGCTGCCTGGG - Intergenic
956659113 3:71582192-71582214 ACCTGTTGTGAGCTCCGCCTTGG - Intronic
957833507 3:85554039-85554061 AACGTTGGGGACCGCTGCCTTGG - Intronic
958682812 3:97353143-97353165 GCCTGTGGTGAGTACTGCCTTGG - Intronic
961473423 3:127132565-127132587 AGCTGTGGCCAACGCTGCCTAGG - Intergenic
962939534 3:140113276-140113298 ACCTTTGGGGAGCACAGCCTGGG - Intronic
966370294 3:179244598-179244620 ACCTGTGGTGTGCACTGCCACGG - Exonic
967191819 3:186991376-186991398 AACTGTGAGGGGCGCTGTCTTGG + Intronic
968005066 3:195237029-195237051 AGCTGTGAGCTGCGCTGCCTGGG + Intronic
968235444 3:197028203-197028225 ACCTGGTGGGAGCACTGGCTAGG + Intronic
968549186 4:1213686-1213708 CCCTGTGGGGGGCCCTGCCTGGG + Intronic
969879203 4:10159052-10159074 ACCTTTGCTGAGAGCTGCCTGGG - Intergenic
969993634 4:11289927-11289949 ATGGGTGGGCAGCGCTGCCTGGG - Intergenic
970233499 4:13934461-13934483 ACCTGTGTGGAGCCCTCACTGGG + Intergenic
978986890 4:115024108-115024130 CCCTGTGAGGAGGTCTGCCTGGG - Intronic
984548967 4:181138339-181138361 ACCAGTGGGAAGCCCGGCCTTGG + Intergenic
985690879 5:1311607-1311629 ACCTGTGGGGAGCCCTGCCCTGG - Intergenic
985992933 5:3578249-3578271 ACCTCTGGGAAGCCCCGCCTGGG - Intergenic
990175367 5:53102419-53102441 TCCTTTGGGGAGCACTCCCTCGG + Intronic
990466395 5:56075666-56075688 GGCTGTGGGGAACGCTGCCTGGG + Intergenic
991971391 5:72145049-72145071 AGCTGTGGGGAGCACTGTCTGGG + Intronic
992228497 5:74641096-74641118 ACCTTAGGGGAGCGCAGCCCGGG + Exonic
998131738 5:139654945-139654967 ACCTGTGGGGAGGGACGGCTGGG - Intronic
1002599875 5:180348008-180348030 TCCTGTGTGGAGCACTGGCTGGG - Intronic
1003247705 6:4398347-4398369 ACCTGAGAGGAGCGCTGCTGGGG + Intergenic
1004326405 6:14677530-14677552 ATCTGTGGGGAGGGCTGACCAGG - Intergenic
1006137259 6:31902474-31902496 AGCTGTGCCGAGCGCTGCCCTGG + Intronic
1006792550 6:36713640-36713662 CCCTGCTGGGAGGGCTGCCTTGG + Intronic
1016229736 6:141788627-141788649 AACTGTGAGCTGCGCTGCCTGGG - Intergenic
1018783536 6:167090541-167090563 ACCTTTTGGGAACGCTGTCTTGG - Intergenic
1023429642 7:40076449-40076471 GCCTGTGGGGAGAGATGCATTGG + Intronic
1028181474 7:87730080-87730102 GCCTGTGGTGAGAACTGCCTGGG - Intronic
1030267332 7:107633841-107633863 TCCTGTAGGGTGAGCTGCCTGGG - Intergenic
1031260062 7:119507126-119507148 GCCTGTGGTGAGAACTGCCTGGG - Intergenic
1034002541 7:147431603-147431625 ACCTTTGTGGAGGGCTGTCTTGG - Intronic
1034126345 7:148675181-148675203 AGCTGTGAGTTGCGCTGCCTGGG - Intergenic
1034498343 7:151435067-151435089 ACCTGTGCCCAGCTCTGCCTCGG + Intronic
1036756869 8:11476842-11476864 TCCTGGGGGGATCACTGCCTTGG + Intergenic
1037504177 8:19514332-19514354 ATCTGTGTGGACAGCTGCCTTGG + Intronic
1037961451 8:23101525-23101547 CCCTGTGTGGAGCACTGCCTAGG - Intronic
1037970179 8:23166049-23166071 CCCTGTGTGGAGCACTGACTAGG + Intergenic
1043413927 8:80029735-80029757 ACCAGCGGGGAGCGCTGCTGGGG - Intronic
1048375789 8:133821445-133821467 TCCTGTGGGGAGGACTGGCTGGG + Intergenic
1049575731 8:143388835-143388857 ACCTGAGGGGAGGACTGCCTGGG + Intergenic
1049603163 8:143517442-143517464 ACCTGCTTGGAGCGCGGCCTGGG - Intronic
1055704639 9:78984306-78984328 ACCTGTGGTGGGCGGTGGCTCGG + Intergenic
1060555805 9:124506707-124506729 ACCTGTGGGGGTGGGTGCCTCGG - Intronic
1062476095 9:136728251-136728273 ACCGCTGGGGGGCGCTGCTTGGG - Intergenic
1062512380 9:136913957-136913979 ACCTGTGGGGCTCGCTGGATAGG + Intronic
1187317197 X:18207002-18207024 ATCTGTGGGGGGAGGTGCCTAGG - Intronic
1188425055 X:30036806-30036828 AGCTGTGAGCTGCGCTGCCTGGG + Intergenic
1190059748 X:47203061-47203083 ACCTGTGGGGAGGGCATCATTGG + Intronic
1194692986 X:97009874-97009896 AGCTGTGGGCTGCACTGCCTGGG + Intronic
1195874946 X:109530293-109530315 ACCTTTGGGGAGTGTTGACTGGG + Intergenic
1197792365 X:130268679-130268701 CCCTCTGGGGAAGGCTGCCTCGG + Intronic
1198577363 X:138025232-138025254 ACCTGTGTGGAGCGCAGATTGGG + Intergenic
1200910232 Y:8525369-8525391 GCCTGTGGGTAGCTCTGCTTGGG + Intergenic