ID: 947587587

View in Genome Browser
Species Human (GRCh38)
Location 2:231366102-231366124
Sequence TGGCAAGCGCAGAATCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947587587 Original CRISPR TGGCAAGCGCAGAATCTGAT GGG Intronic
901159153 1:7161862-7161884 GGGCAAGCAATGAATCTGATTGG + Intronic
901719949 1:11189089-11189111 TGGCAGGGGCATAATCTAATAGG + Intronic
902415202 1:16234490-16234512 TGTCCAGCCCAGGATCTGATGGG - Intronic
902878205 1:19353475-19353497 TGGCAAGGGCAGAAACAGAAGGG - Intronic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907082329 1:51635168-51635190 TGTCAAGAGCAGAGTGTGATGGG + Intronic
910538614 1:88329149-88329171 TGGCAAGTCCAAAATCTGATGGG + Intergenic
911744162 1:101420772-101420794 TGGCAAGTCCAAAATCTGATAGG - Intergenic
913392681 1:118331964-118331986 TGGCAAGCCGAAAATCTGAAAGG + Intergenic
923515712 1:234696255-234696277 TGTCAAGGGCAGAAACTGGTAGG - Intergenic
1067966102 10:50914552-50914574 TGGCTAGGACAGATTCTGATTGG + Intergenic
1069266609 10:66466225-66466247 TGGCAAGCCCAGAATATGCAGGG - Intronic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1072394845 10:95027970-95027992 TGGTAAGCATAGTATCTGATAGG + Intergenic
1077656844 11:4027700-4027722 TGACAAGAGAAGAATCAGATTGG + Intronic
1082251883 11:49991653-49991675 TGGGAAGGGCAGAATGAGATTGG - Intergenic
1089132526 11:116223873-116223895 GAGCAAGCCCAGAATCTGACTGG + Intergenic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1091801919 12:3329768-3329790 TAACAAGAGCAGAATCTCATGGG + Intergenic
1093602660 12:21048221-21048243 TGGCAGGCTCAAAATCTCATAGG + Intronic
1097480508 12:60118321-60118343 TGGTGAGCACAGTATCTGATAGG - Intergenic
1098008566 12:66025170-66025192 TGGCAAGTGCAGAATTTTAGTGG + Intergenic
1100198437 12:92273279-92273301 TGGCAAGTCCACAATCTGATGGG - Intergenic
1100793982 12:98160485-98160507 TGTTAAGCCCAGAAACTGATGGG + Intergenic
1102869792 12:116404973-116404995 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
1104284357 12:127411216-127411238 TGGCAAGCACAGATTCTGGATGG + Intergenic
1106451523 13:29886805-29886827 TGGCAAAGGCAGAATTTGAATGG - Intergenic
1106456762 13:29934634-29934656 TGGGAAGTGGAGTATCTGATTGG + Intergenic
1107626141 13:42287142-42287164 TGGCAGGCCCAGAAGCTCATAGG - Intronic
1110531432 13:76603097-76603119 TGGGAAGCTTAGAATCTCATGGG - Intergenic
1111186850 13:84748717-84748739 TGGTAAGTCCAAAATCTGATCGG - Intergenic
1113357107 13:109591413-109591435 TGGTAAGAGCAGTATCTGGTAGG + Intergenic
1120192566 14:81452489-81452511 TGTCAGGCACAGAATCTGCTAGG + Intergenic
1120756318 14:88247621-88247643 GGGCAAGTGGAGAATCTGTTTGG + Intronic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1121960869 14:98258261-98258283 TGGCAAGTTCAGAGTCTGGTGGG + Intergenic
1122725483 14:103748006-103748028 TGGCAAGTCCAGAATCTGTGAGG - Intronic
1202899372 14_GL000194v1_random:26669-26691 AGGCTAGCGCAGGAGCTGATGGG + Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1124989581 15:34658306-34658328 TGGCAAGCTCAAAATCTGCAGGG + Intergenic
1129360086 15:75019160-75019182 TGCCAAGAGCAGAATCTGAAAGG - Exonic
1130015970 15:80186643-80186665 TGGCAAGCCCAAAACCTGCTGGG + Exonic
1130389715 15:83445079-83445101 TAGCAAGGGCAGCATCTGATTGG - Intergenic
1134280521 16:12812864-12812886 TGGCAAGTGCAAAATCTGCAAGG - Intergenic
1139490312 16:67282413-67282435 TGGCTAGCTCAGAACCTGGTAGG + Intronic
1144101715 17:11947738-11947760 TGGCCAGCCCAGAATCTGGGAGG + Intronic
1144311799 17:14020697-14020719 TGGCAATTGCAGAATCTAGTCGG + Intergenic
1144332959 17:14240620-14240642 TGGCAATTGCAGAATCTAGTCGG - Intergenic
1149639737 17:58194977-58194999 GGGGAAGCGCACAATCTGGTTGG - Exonic
1150138259 17:62707529-62707551 TGCAAAGGGCACAATCTGATTGG + Intronic
1153348662 18:4055386-4055408 TGATAAGCACAGAACCTGATAGG + Intronic
1157689834 18:49672457-49672479 TGGTGAGCCCAAAATCTGATGGG + Intergenic
1159079925 18:63725494-63725516 TGGCAAGTGCAAAATCTGCAGGG + Intronic
927020514 2:19011966-19011988 TGGCAAGAGCAGCAGCAGATGGG - Intergenic
929764786 2:44835232-44835254 CTGCAAGCTCAGCATCTGATAGG - Intergenic
933264715 2:80169383-80169405 TGGGAAGGCCAGATTCTGATTGG - Intronic
933567438 2:83968481-83968503 TGGCAAGTGCAAAATCTGCAGGG + Intergenic
935431469 2:102980477-102980499 AGACAAGCTCAGAATCTGCTGGG - Intergenic
936348730 2:111696400-111696422 TGGCAAGCCCAAAATCTGCAAGG + Intergenic
937024873 2:118689649-118689671 TTGCACGGGGAGAATCTGATTGG - Intergenic
945450950 2:209994381-209994403 TGGCAGGAGCAGTATCTGTTTGG - Intronic
947380626 2:229541777-229541799 TGGCAAGTGCAATATCTAATGGG - Intronic
947395280 2:229680525-229680547 ACACAAGTGCAGAATCTGATGGG + Intronic
947529804 2:230901588-230901610 TGTCAAAGGCAGAATCTGCTGGG + Intergenic
947587587 2:231366102-231366124 TGGCAAGCGCAGAATCTGATGGG + Intronic
1173896533 20:46555252-46555274 TAGCAAGTCCAAAATCTGATGGG - Intergenic
1178153705 21:29826591-29826613 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1180384420 22:12168863-12168885 GGGCTAGCGCAGAGGCTGATGGG - Intergenic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184156544 22:42671258-42671280 TGGCAAGCACAGTACCTGACGGG - Intergenic
1184938556 22:47742632-47742654 TGGCAAGTTTAGAATCTGTTGGG + Intergenic
949262539 3:2119224-2119246 TGGCAAGTGCAAAATCTGCAGGG - Intronic
950647554 3:14386374-14386396 TGTCAAGAGCAGAAGCTGAGAGG + Intergenic
950906735 3:16545573-16545595 AGAAAAGGGCAGAATCTGATTGG + Intergenic
951966332 3:28389762-28389784 TGGCAAGTCCAGTTTCTGATGGG + Intronic
952231032 3:31431457-31431479 TAGCAAGTACAAAATCTGATAGG + Intergenic
953242110 3:41158879-41158901 TGGCAAGTGCTGACTCTGCTCGG - Intergenic
958931687 3:100214453-100214475 TGGCAAGTCCAAAATCTGACAGG + Intergenic
964677423 3:159299469-159299491 AGGCAAGAGTAGAATCTGAAGGG + Intronic
968039055 3:195573106-195573128 TGAAAAGGGCAGAATCTGCTGGG - Intronic
973166520 4:47084655-47084677 TGGGAAGCTCAGAATCAGGTAGG - Intronic
974192660 4:58527163-58527185 TGGCAAATGCAAAATCTGATGGG - Intergenic
978061471 4:104345024-104345046 TGGAAAGAGCACCATCTGATTGG - Intergenic
979037958 4:115749620-115749642 TAGCAAGGGCAGAAACTGATAGG - Intergenic
979911739 4:126375850-126375872 TGGCAACCACAAATTCTGATGGG - Intergenic
981172301 4:141638495-141638517 TGGCAACTCCAGAACCTGATTGG + Intronic
981239154 4:142454283-142454305 TGGCAAGGGCAGAATGTGAAAGG - Intronic
981642513 4:146961140-146961162 TGGCAAGCACAGAATTAGAAAGG - Intergenic
982732453 4:158970871-158970893 TGGCACGCTCAGAAACTGCTTGG - Intronic
989712564 5:44417515-44417537 TGGCAAGTGCAAAATCTGCAAGG - Intergenic
992925998 5:81587900-81587922 TGGCAAGCCCAGAAAATGATTGG - Intronic
992995599 5:82329446-82329468 TGGAAGGCACAGAAGCTGATTGG - Intronic
995138281 5:108703890-108703912 TGGCAAGCCCAAAATCTGGAGGG - Intergenic
996217855 5:120891263-120891285 TGGCTGTGGCAGAATCTGATGGG + Intergenic
997393814 5:133540165-133540187 TGGCAAATCCAGAATCTGATGGG - Intronic
1000029682 5:157390923-157390945 TGGCATCAGCAGAGTCTGATTGG - Intronic
1004700621 6:18075987-18076009 TAGCCAGAGCAGACTCTGATTGG + Intergenic
1005107071 6:22235166-22235188 TGGAAAGGGCAAACTCTGATTGG + Intergenic
1009439406 6:63658832-63658854 TGGCAAGCCCAAAATCTGCAGGG + Intronic
1009447726 6:63763227-63763249 TGGCTAGAGCAGAAGCTGAGGGG + Intronic
1010083302 6:71887476-71887498 TGGGAAGTGCAGAAGCTGAGAGG + Intronic
1013845668 6:114447936-114447958 TGGCAGGGGCAGAACCTGGTGGG - Intergenic
1014361667 6:120484434-120484456 TGGCAAGTCCAAAATCTGCTGGG - Intergenic
1017321965 6:153105008-153105030 TGGCCAGAGCAGAATCAGAAAGG + Intronic
1022639227 7:32165676-32165698 TGTCAAGGGAAGAATCTGATGGG - Intronic
1024345284 7:48307055-48307077 TGGCAAGCCCAAAATCTGCAGGG - Intronic
1024889551 7:54184686-54184708 TGGCCAGAGCAGAAGCTGCTTGG + Intergenic
1027916003 7:84322167-84322189 TGTCAAGGGCAGAACCTGGTGGG - Intronic
1030453407 7:109742725-109742747 TGGTAAGTCCAAAATCTGATGGG + Intergenic
1031395524 7:121269112-121269134 TAGCAAGCGTAGTATCTAATAGG + Intronic
1037782093 8:21876763-21876785 TGGGAAGCACAGTCTCTGATAGG + Intergenic
1040107019 8:43547023-43547045 GGTCCAGCGCAGAATCTGATGGG + Intergenic
1040309798 8:46230950-46230972 TGGCAAGCGCCGAGTCTCAGTGG + Intergenic
1041178154 8:55219285-55219307 TGGGAAGAGCAGATTCTGAATGG - Intronic
1041397286 8:57404333-57404355 TGGCAAGTGAAGAATATGGTCGG + Intergenic
1042889657 8:73593799-73593821 TGGCTAGTGTAAAATCTGATGGG - Intronic
1044459077 8:92423902-92423924 TGGATAGCTCAGAATATGATTGG + Intergenic
1046560486 8:115831202-115831224 TGGCAAAAGCAAAATCTGCTTGG - Intergenic
1047334098 8:123919773-123919795 GGGCAAGCGCAGACTCTCATAGG + Intronic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1051345060 9:16144001-16144023 TGGCAAGTGCAAAATCTGCAGGG + Intergenic
1051488094 9:17630540-17630562 TGGGAAGGGCAGAATGTGGTAGG + Intronic
1051652171 9:19338834-19338856 TGGCAAACCCAGAGTCTGAGTGG + Intronic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056537978 9:87547663-87547685 TGGCAAGTCCAGAATTTGCTGGG + Intronic
1058068683 9:100579240-100579262 TGCCAAGCGCAGAATAATATGGG - Intronic
1188065586 X:25655761-25655783 TGGCCAGCCCAGATTCTGAGGGG + Intergenic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1191038833 X:56057287-56057309 TGGCAAGCACAGAATCAGCAAGG - Intergenic
1192772182 X:74204428-74204450 AGGCAAAAGCAGAATCTGAGGGG - Intergenic
1194560862 X:95418140-95418162 TGGCAAGTCCAAAATCTGACAGG + Intergenic
1196786351 X:119424640-119424662 TTGCAAGCTCAGAAACTGAGAGG + Intronic
1199561831 X:149171757-149171779 TGGCAAGGGAGGAACCTGATGGG - Intergenic
1199896807 X:152134860-152134882 TGGGAAGCACTGAATATGATGGG - Exonic
1201152453 Y:11101521-11101543 GGGCTAGCGCAGGAGCTGATAGG + Intergenic