ID: 947589608

View in Genome Browser
Species Human (GRCh38)
Location 2:231378091-231378113
Sequence AATGTTTACCAGCACTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947589597_947589608 15 Left 947589597 2:231378053-231378075 CCAGAGCTTTAGCCCCCACCCCC No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589600_947589608 2 Left 947589600 2:231378066-231378088 CCCCACCCCCAAGAGCCGGTTAT No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589601_947589608 1 Left 947589601 2:231378067-231378089 CCCACCCCCAAGAGCCGGTTATT No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589603_947589608 -3 Left 947589603 2:231378071-231378093 CCCCCAAGAGCCGGTTATTAAAT No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589602_947589608 0 Left 947589602 2:231378068-231378090 CCACCCCCAAGAGCCGGTTATTA No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589596_947589608 22 Left 947589596 2:231378046-231378068 CCACAAACCAGAGCTTTAGCCCC No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589604_947589608 -4 Left 947589604 2:231378072-231378094 CCCCAAGAGCCGGTTATTAAATG No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589606_947589608 -6 Left 947589606 2:231378074-231378096 CCAAGAGCCGGTTATTAAATGTT No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589605_947589608 -5 Left 947589605 2:231378073-231378095 CCCAAGAGCCGGTTATTAAATGT No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data
947589599_947589608 3 Left 947589599 2:231378065-231378087 CCCCCACCCCCAAGAGCCGGTTA No data
Right 947589608 2:231378091-231378113 AATGTTTACCAGCACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947589608 Original CRISPR AATGTTTACCAGCACTCCAC TGG Intergenic
No off target data available for this crispr