ID: 947589735

View in Genome Browser
Species Human (GRCh38)
Location 2:231378785-231378807
Sequence CTGGGTTTACTGAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947589726_947589735 0 Left 947589726 2:231378762-231378784 CCTGAGGGGCAGGACCAGGGACC No data
Right 947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG No data
947589717_947589735 17 Left 947589717 2:231378745-231378767 CCCAGTGGCTTATAGGCCCTGAG No data
Right 947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG No data
947589725_947589735 1 Left 947589725 2:231378761-231378783 CCCTGAGGGGCAGGACCAGGGAC No data
Right 947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG No data
947589715_947589735 30 Left 947589715 2:231378732-231378754 CCAGGCAGAGGGTCCCAGTGGCT No data
Right 947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG No data
947589718_947589735 16 Left 947589718 2:231378746-231378768 CCAGTGGCTTATAGGCCCTGAGG No data
Right 947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947589735 Original CRISPR CTGGGTTTACTGAGGGAAGG TGG Intergenic
No off target data available for this crispr