ID: 947590162

View in Genome Browser
Species Human (GRCh38)
Location 2:231380828-231380850
Sequence CAGGGAAATCAGCATTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947590147_947590162 24 Left 947590147 2:231380781-231380803 CCCTTCCATCGGGAGGTGCCGAT No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590158_947590162 -5 Left 947590158 2:231380810-231380832 CCAGGGCTCGGGTGCTTCCAGGG No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590146_947590162 30 Left 947590146 2:231380775-231380797 CCTTTACCCTTCCATCGGGAGGT No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590156_947590162 -4 Left 947590156 2:231380809-231380831 CCCAGGGCTCGGGTGCTTCCAGG No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590150_947590162 19 Left 947590150 2:231380786-231380808 CCATCGGGAGGTGCCGATGGATG No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590148_947590162 23 Left 947590148 2:231380782-231380804 CCTTCCATCGGGAGGTGCCGATG No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data
947590154_947590162 6 Left 947590154 2:231380799-231380821 CCGATGGATGCCCAGGGCTCGGG No data
Right 947590162 2:231380828-231380850 CAGGGAAATCAGCATTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947590162 Original CRISPR CAGGGAAATCAGCATTTGGC TGG Intergenic
No off target data available for this crispr