ID: 947592974

View in Genome Browser
Species Human (GRCh38)
Location 2:231395704-231395726
Sequence GGCGGGTGGGGACGGAGACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592974_947592986 3 Left 947592974 2:231395704-231395726 CCCGGTCTCCGTCCCCACCCGCC 0: 1
1: 0
2: 2
3: 37
4: 362
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592974_947592980 -9 Left 947592974 2:231395704-231395726 CCCGGTCTCCGTCCCCACCCGCC 0: 1
1: 0
2: 2
3: 37
4: 362
Right 947592980 2:231395718-231395740 CCACCCGCCCGCCGTCCCGCCGG 0: 1
1: 0
2: 7
3: 24
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592974 Original CRISPR GGCGGGTGGGGACGGAGACC GGG (reversed) Exonic