ID: 947592975

View in Genome Browser
Species Human (GRCh38)
Location 2:231395705-231395727
Sequence GGGCGGGTGGGGACGGAGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592975_947592986 2 Left 947592975 2:231395705-231395727 CCGGTCTCCGTCCCCACCCGCCC 0: 1
1: 1
2: 5
3: 65
4: 723
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592975_947592980 -10 Left 947592975 2:231395705-231395727 CCGGTCTCCGTCCCCACCCGCCC 0: 1
1: 1
2: 5
3: 65
4: 723
Right 947592980 2:231395718-231395740 CCACCCGCCCGCCGTCCCGCCGG 0: 1
1: 0
2: 7
3: 24
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592975 Original CRISPR GGGCGGGTGGGGACGGAGAC CGG (reversed) Exonic