ID: 947592976

View in Genome Browser
Species Human (GRCh38)
Location 2:231395712-231395734
Sequence GGACGGCGGGCGGGTGGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 0, 2: 5, 3: 107, 4: 1041}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592976_947592986 -5 Left 947592976 2:231395712-231395734 CCGTCCCCACCCGCCCGCCGTCC 0: 1
1: 0
2: 5
3: 107
4: 1041
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592976 Original CRISPR GGACGGCGGGCGGGTGGGGA CGG (reversed) Exonic