ID: 947592977

View in Genome Browser
Species Human (GRCh38)
Location 2:231395716-231395738
Sequence GGCGGGACGGCGGGCGGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 956
Summary {0: 1, 1: 0, 2: 7, 3: 116, 4: 832}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592977_947592986 -9 Left 947592977 2:231395716-231395738 CCCCACCCGCCCGCCGTCCCGCC 0: 1
1: 0
2: 7
3: 116
4: 832
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592977 Original CRISPR GGCGGGACGGCGGGCGGGTG GGG (reversed) Exonic