ID: 947592978

View in Genome Browser
Species Human (GRCh38)
Location 2:231395717-231395739
Sequence CGGCGGGACGGCGGGCGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592978_947592986 -10 Left 947592978 2:231395717-231395739 CCCACCCGCCCGCCGTCCCGCCG 0: 1
1: 0
2: 7
3: 59
4: 465
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592978_947592996 30 Left 947592978 2:231395717-231395739 CCCACCCGCCCGCCGTCCCGCCG 0: 1
1: 0
2: 7
3: 59
4: 465
Right 947592996 2:231395770-231395792 CGCTCGCCCCTCCGCCGCTCCGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592978 Original CRISPR CGGCGGGACGGCGGGCGGGT GGG (reversed) Exonic