ID: 947592986

View in Genome Browser
Species Human (GRCh38)
Location 2:231395730-231395752
Sequence CGTCCCGCCGGCCCGAGCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947592978_947592986 -10 Left 947592978 2:231395717-231395739 CCCACCCGCCCGCCGTCCCGCCG 0: 1
1: 0
2: 7
3: 59
4: 465
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592976_947592986 -5 Left 947592976 2:231395712-231395734 CCGTCCCCACCCGCCCGCCGTCC 0: 1
1: 0
2: 5
3: 107
4: 1041
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592974_947592986 3 Left 947592974 2:231395704-231395726 CCCGGTCTCCGTCCCCACCCGCC 0: 1
1: 0
2: 2
3: 37
4: 362
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592975_947592986 2 Left 947592975 2:231395705-231395727 CCGGTCTCCGTCCCCACCCGCCC 0: 1
1: 1
2: 5
3: 65
4: 723
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106
947592977_947592986 -9 Left 947592977 2:231395716-231395738 CCCCACCCGCCCGCCGTCCCGCC 0: 1
1: 0
2: 7
3: 116
4: 832
Right 947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947592986 Original CRISPR CGTCCCGCCGGCCCGAGCCG TGG Exonic