ID: 947594871

View in Genome Browser
Species Human (GRCh38)
Location 2:231404691-231404713
Sequence GTATGAGGTCACAAAGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947594863_947594871 7 Left 947594863 2:231404661-231404683 CCCAAACTTTGCAGTATTAGCCA No data
Right 947594871 2:231404691-231404713 GTATGAGGTCACAAAGTAGGGGG No data
947594864_947594871 6 Left 947594864 2:231404662-231404684 CCAAACTTTGCAGTATTAGCCAA No data
Right 947594871 2:231404691-231404713 GTATGAGGTCACAAAGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947594871 Original CRISPR GTATGAGGTCACAAAGTAGG GGG Intergenic
No off target data available for this crispr