ID: 947594994

View in Genome Browser
Species Human (GRCh38)
Location 2:231405486-231405508
Sequence TGCACTTGAAGGGTTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947594994_947595000 16 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595000 2:231405525-231405547 GAAAAGGGCCTATTGAACTCTGG No data
947594994_947595003 19 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG No data
947594994_947594998 0 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947594998 2:231405509-231405531 TGAAGCATCATATAAAGAAAAGG No data
947594994_947595002 18 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data
947594994_947595005 24 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595005 2:231405533-231405555 CCTATTGAACTCTGGGGGAAAGG No data
947594994_947594999 1 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947594999 2:231405510-231405532 GAAGCATCATATAAAGAAAAGGG No data
947594994_947595001 17 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595001 2:231405526-231405548 AAAAGGGCCTATTGAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947594994 Original CRISPR TGCACTTGAAGGGTTAAAAA GGG (reversed) Intergenic