ID: 947594997

View in Genome Browser
Species Human (GRCh38)
Location 2:231405497-231405519
Sequence ATGATGCTTCATGCACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947594997_947594999 -10 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947594999 2:231405510-231405532 GAAGCATCATATAAAGAAAAGGG No data
947594997_947595001 6 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595001 2:231405526-231405548 AAAAGGGCCTATTGAACTCTGGG No data
947594997_947595002 7 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data
947594997_947595000 5 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595000 2:231405525-231405547 GAAAAGGGCCTATTGAACTCTGG No data
947594997_947595005 13 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595005 2:231405533-231405555 CCTATTGAACTCTGGGGGAAAGG No data
947594997_947595003 8 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947594997 Original CRISPR ATGATGCTTCATGCACTTGA AGG (reversed) Intergenic