ID: 947595002

View in Genome Browser
Species Human (GRCh38)
Location 2:231405527-231405549
Sequence AAAGGGCCTATTGAACTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947594994_947595002 18 Left 947594994 2:231405486-231405508 CCCTTTTTAACCCTTCAAGTGCA No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data
947594997_947595002 7 Left 947594997 2:231405497-231405519 CCTTCAAGTGCATGAAGCATCAT No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data
947594996_947595002 8 Left 947594996 2:231405496-231405518 CCCTTCAAGTGCATGAAGCATCA No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data
947594995_947595002 17 Left 947594995 2:231405487-231405509 CCTTTTTAACCCTTCAAGTGCAT No data
Right 947595002 2:231405527-231405549 AAAGGGCCTATTGAACTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947595002 Original CRISPR AAAGGGCCTATTGAACTCTG GGG Intergenic