ID: 947596051

View in Genome Browser
Species Human (GRCh38)
Location 2:231412412-231412434
Sequence GCCCTGCAGCCGGCACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596051_947596062 -6 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596062 2:231412429-231412451 CAGGGCCGCGGGTCGGGGCGGGG No data
947596051_947596064 4 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596064 2:231412439-231412461 GGTCGGGGCGGGGCCCCGCGAGG No data
947596051_947596076 30 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596076 2:231412465-231412487 AAGGGGCTGGCCGGGCTGGAGGG No data
947596051_947596075 29 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596075 2:231412464-231412486 CAAGGGGCTGGCCGGGCTGGAGG No data
947596051_947596069 17 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596051_947596072 21 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG No data
947596051_947596060 -8 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596060 2:231412427-231412449 TGCAGGGCCGCGGGTCGGGGCGG No data
947596051_947596065 11 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596065 2:231412446-231412468 GCGGGGCCCCGCGAGGAGCAAGG No data
947596051_947596073 22 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596073 2:231412457-231412479 CGAGGAGCAAGGGGCTGGCCGGG No data
947596051_947596074 26 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596074 2:231412461-231412483 GAGCAAGGGGCTGGCCGGGCTGG No data
947596051_947596067 13 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596067 2:231412448-231412470 GGGGCCCCGCGAGGAGCAAGGGG No data
947596051_947596066 12 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596066 2:231412447-231412469 CGGGGCCCCGCGAGGAGCAAGGG No data
947596051_947596061 -7 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596061 2:231412428-231412450 GCAGGGCCGCGGGTCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596051 Original CRISPR GCCCTGCAGCCGGCACTGGG AGG (reversed) Intergenic
No off target data available for this crispr