ID: 947596052

View in Genome Browser
Species Human (GRCh38)
Location 2:231412415-231412437
Sequence GCGGCCCTGCAGCCGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596052_947596067 10 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596067 2:231412448-231412470 GGGGCCCCGCGAGGAGCAAGGGG No data
947596052_947596061 -10 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596061 2:231412428-231412450 GCAGGGCCGCGGGTCGGGGCGGG No data
947596052_947596064 1 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596064 2:231412439-231412461 GGTCGGGGCGGGGCCCCGCGAGG No data
947596052_947596073 19 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596073 2:231412457-231412479 CGAGGAGCAAGGGGCTGGCCGGG No data
947596052_947596074 23 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596074 2:231412461-231412483 GAGCAAGGGGCTGGCCGGGCTGG No data
947596052_947596066 9 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596066 2:231412447-231412469 CGGGGCCCCGCGAGGAGCAAGGG No data
947596052_947596065 8 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596065 2:231412446-231412468 GCGGGGCCCCGCGAGGAGCAAGG No data
947596052_947596072 18 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG No data
947596052_947596075 26 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596075 2:231412464-231412486 CAAGGGGCTGGCCGGGCTGGAGG No data
947596052_947596069 14 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596052_947596076 27 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596076 2:231412465-231412487 AAGGGGCTGGCCGGGCTGGAGGG No data
947596052_947596062 -9 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596062 2:231412429-231412451 CAGGGCCGCGGGTCGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596052 Original CRISPR GCGGCCCTGCAGCCGGCACT GGG (reversed) Intergenic
No off target data available for this crispr