ID: 947596053

View in Genome Browser
Species Human (GRCh38)
Location 2:231412416-231412438
Sequence CGCGGCCCTGCAGCCGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596053_947596064 0 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596064 2:231412439-231412461 GGTCGGGGCGGGGCCCCGCGAGG No data
947596053_947596062 -10 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596062 2:231412429-231412451 CAGGGCCGCGGGTCGGGGCGGGG No data
947596053_947596075 25 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596075 2:231412464-231412486 CAAGGGGCTGGCCGGGCTGGAGG No data
947596053_947596069 13 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596053_947596073 18 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596073 2:231412457-231412479 CGAGGAGCAAGGGGCTGGCCGGG No data
947596053_947596074 22 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596074 2:231412461-231412483 GAGCAAGGGGCTGGCCGGGCTGG No data
947596053_947596065 7 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596065 2:231412446-231412468 GCGGGGCCCCGCGAGGAGCAAGG No data
947596053_947596066 8 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596066 2:231412447-231412469 CGGGGCCCCGCGAGGAGCAAGGG No data
947596053_947596072 17 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG No data
947596053_947596067 9 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596067 2:231412448-231412470 GGGGCCCCGCGAGGAGCAAGGGG No data
947596053_947596076 26 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596076 2:231412465-231412487 AAGGGGCTGGCCGGGCTGGAGGG No data
947596053_947596077 30 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596077 2:231412469-231412491 GGCTGGCCGGGCTGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596053 Original CRISPR CGCGGCCCTGCAGCCGGCAC TGG (reversed) Intergenic
No off target data available for this crispr