ID: 947596056

View in Genome Browser
Species Human (GRCh38)
Location 2:231412422-231412444
Sequence CCGACCCGCGGCCCTGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596056_947596075 19 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596075 2:231412464-231412486 CAAGGGGCTGGCCGGGCTGGAGG No data
947596056_947596074 16 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596074 2:231412461-231412483 GAGCAAGGGGCTGGCCGGGCTGG No data
947596056_947596073 12 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596073 2:231412457-231412479 CGAGGAGCAAGGGGCTGGCCGGG No data
947596056_947596066 2 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596066 2:231412447-231412469 CGGGGCCCCGCGAGGAGCAAGGG No data
947596056_947596064 -6 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596064 2:231412439-231412461 GGTCGGGGCGGGGCCCCGCGAGG No data
947596056_947596069 7 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596056_947596076 20 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596076 2:231412465-231412487 AAGGGGCTGGCCGGGCTGGAGGG No data
947596056_947596072 11 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG No data
947596056_947596077 24 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596077 2:231412469-231412491 GGCTGGCCGGGCTGGAGGGCTGG No data
947596056_947596065 1 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596065 2:231412446-231412468 GCGGGGCCCCGCGAGGAGCAAGG No data
947596056_947596078 25 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596078 2:231412470-231412492 GCTGGCCGGGCTGGAGGGCTGGG No data
947596056_947596067 3 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596067 2:231412448-231412470 GGGGCCCCGCGAGGAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596056 Original CRISPR CCGACCCGCGGCCCTGCAGC CGG (reversed) Intergenic
No off target data available for this crispr