ID: 947596063

View in Genome Browser
Species Human (GRCh38)
Location 2:231412434-231412456
Sequence CGGGGCCCCGCCCCGACCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596063_947596066 -10 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596066 2:231412447-231412469 CGGGGCCCCGCGAGGAGCAAGGG No data
947596063_947596073 0 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596073 2:231412457-231412479 CGAGGAGCAAGGGGCTGGCCGGG No data
947596063_947596077 12 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596077 2:231412469-231412491 GGCTGGCCGGGCTGGAGGGCTGG No data
947596063_947596075 7 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596075 2:231412464-231412486 CAAGGGGCTGGCCGGGCTGGAGG No data
947596063_947596080 29 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596080 2:231412486-231412508 GGCTGGGTGAGTCCCCGCCCTGG No data
947596063_947596067 -9 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596067 2:231412448-231412470 GGGGCCCCGCGAGGAGCAAGGGG No data
947596063_947596072 -1 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596072 2:231412456-231412478 GCGAGGAGCAAGGGGCTGGCCGG No data
947596063_947596076 8 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596076 2:231412465-231412487 AAGGGGCTGGCCGGGCTGGAGGG No data
947596063_947596074 4 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596074 2:231412461-231412483 GAGCAAGGGGCTGGCCGGGCTGG No data
947596063_947596078 13 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596078 2:231412470-231412492 GCTGGCCGGGCTGGAGGGCTGGG No data
947596063_947596069 -5 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596063 Original CRISPR CGGGGCCCCGCCCCGACCCG CGG (reversed) Intergenic
No off target data available for this crispr